Detection of blaNDM-1gene for the production of MBL among Clinical Strains of Escherichia coli
Rene Jochebed. S1, Dr. P. Gopinath2
1BDS Student, Saveetha Dental College, Chennai.
2Senior Lecturer, Department of Microbiology, Saveetha Dental College, Chennai.
Corresponding Author E-mail: alakshmiusha@gmail.com
ABSTRACT:
The commonly known carbapenemasesin Enterobacteriaceae are IMP, VIM, KPC and OXA-48. In addition, a newer class of New Delhi metallo-beta-lactamases-1 (NDM-1) has been reported worldwide since 2008, originating mostly from the Indian sub continental region. However, there is still controversy regarding the source and the impact on patient’s treatment of infections caused by blaNDM-1producing isolates. A total of 20 clinical isolates of E. coli were subjected to antibiotic susceptibility pattern followed by the detection of blaNDM-1gene by PCR. Our results indicate the increased degree of resistance to most of the routinely used antibiotics However, 30% of these isolates were resistant to imipenem. Upon PCR for this gene, only 15% of them were shown to haveblaNDM-1gene. early recognition of NDM-1 producing Enterobacteriaceae, especially E. coli with any reduced carbapenem susceptibility should have primary importance as high mortality rates are associated with patients infected with these bacteria.
KEYWORDS : E. coli, blaNDM-1, PCR .
INTRODUCTION:
Escherichia coli, one of the most common and frequent etiological agents of urinary tract infection (UTI) and is also responsible for wide array of other infections such as bacteremia, pneumonia, soft-tissue infection and neonatal meningitis.[1] Multipe antibiotic resistance exhibited by such E. coli strains is a major concern, as they are showing resistance even to the carbapenems, which are considered to be the last resort of antibiotics for such suborn E. coli infections. Carbapenem resistance is mainly due to the production of carbapenemase enzymes. Carbapenemase is the most versatile family of beta - lactamases that are increasingly being reported across the world.[2]
The commonly known carbapenemasesin Entero-bacteriaceae are IMP, VIM, KPC and OXA-48. In addition, a newer class of New Delhi metallo-beta-lactamases-1 (NDM-1) has been reported worldwide since 2008, originating mostly from the Indian sub continental region.[3] However, there is still controversy regarding the source and the impact on patient’s treatment of infections caused by blaNDM-1 producing isolates. The major problem with blaNDM-1 producers is
That they show resistance to different classes of antibiotics including beta-lactams, aminoglycosides and fluoroquinolones, which leaves few therapeutic options for the clinicians. The aim of the present study was to detect the presence ofblaNDM-1among E. coli isolates from urinary tract infections.
MATERIALS AND METHODS:
Bacterial Isolates:
A total of 20 non repetitive urinary isolates of Escherichia coli were collected from Saveetha Medical College and Hospitals, Chennai. They were processed for a battery of standard biochemical tests and confirmed. Isolates were preserved in semisolid trypticase soy broth stock and were stored at 4 ºC until further use.
Antibiotic Susceptibility Testing:
Antibiotic susceptibility test was determined for these isolates to routinely used antibiotics such as ampicillin, amoxicillin, amikacin, norfloxacin, ceftazimide, cefotaxime, ciprofloxacin and gentamicin, imipenem as by Kirby Bauer disc diffusion method.[4]
Detection of blaNDM-1gene in E.coli:
Escherichia coli isolates were detected for the presence of blaNDM-1by PCR analysis. Detection of the gene was carried out using primer as depicted in table 1. Bacterial DNA was extracted by boiling lysis method. 1 µL of DNA extract was used as template for PCR reaction. The reaction mixture contained 1mM of Mgcl20.2mM dNTP mix and 0.8µM of blaNDM-1 gene with 0.5U of Taq polymerase (New England Biolabs) in a 1x PCR buffered reaction. A positive control of E.coli with blaNDM-1 gene was also included in this study. PCR amplification was carried out using thermal cycler (Eppendorf) with the following cycling condition. Initial denaturation at 98oC for 5 min and 30 cycles for 30s, 70oC for 30s and 68o C for 60s, followed by a final extension of 5 min at 75oC. PCR products were resolved in 1.5% agarose gel. A 100bp ladder was including in all the gel analysis.[5]
Table 1: Gene Sequencing of blaNDM-1 gene
|
Primer |
Primer Sequence |
Product Size |
|
blaNDM-1 |
CACTTCCTATCTCGACATGC GGGCCGTATGAGTGATTG |
621bp |
RESULTS:
Sample Wise Distribution of Clinical Isolates of E.coli:
Of the 20 clinical isolates of E.coli, 12/20 (60%) were from acute urinary tract infections and 8/20 (40%) were from chronic urinary tract infections. Figure 1 depicts the sample wise distribution of clinical isolates of E.coli.
Figure 1: Sample wise distribution of urinary isolates of E.coli
Antibiotic Susceptibility Testing:
In our isolates, we have found increased percentage 14/20 (70%) of isolates showed sensitivity to amikacin followed by gentamicin, which showed sensitivity of 9/20 (45%). 80- 90% of E.coli isolates showed resistance to cephalosporin group of drugs. 6/20 (30%) were found to be resistant to imipenem. However, we have observed an elevated level of resistance to other routinely used antibiotics. The detailed resistant pattern of E.coli isolates is shown in table 2.
Table 2: Showing Antibiotic Sensitivity Pattern of E.coli
|
Antibiotics |
Sensitivity (20) (%) |
Intermediate (20) (%) |
Resistant (20) (%) |
|
Ampicillin |
5 |
0 |
95 |
|
Amoxicillin |
5 |
0 |
95 |
|
Ceftazidime |
10 |
10 |
80 |
|
Cefotaxime |
5 |
5 |
90 |
|
Amikacin |
70 |
10 |
20 |
|
Gentamicin |
45 |
20 |
35 |
|
Norfloxacin |
15 |
15 |
70 |
|
Ciprofloxacin |
20 |
5 |
75 |
|
Imipenem |
70 |
0 |
30 |
Result of blaNDM-1in E.coli :
2/20 (10%) clinical isolate of urinary isolates of E.coli was found to harbourblaNDM-1 gene.
Figure 2: Representative gel picture showing positive for blaNDM-1 gene
L2-100bp ladder; L6,L7-621bp blaNDM-1 genes
DISCUSSION:
The result of our study showed that, most of these isolates were resistant to multiple antibiotics tested, however only 30% of isolates were resistant to imipenem. Increased percentage of resistance was observed in cephalosporin group of antibiotics. They were subjected for the presence of blaNDM-1gene by PCR. It showed only 2/20 (10%) strain was found to harbor blaNDM-1. blaNDM-1is a transferable class B MBL gene. Since its 1st appearance in 2008, it has been identified in different Gram-negative isolates from different parts of the world including UK, Pakistan, Australia and USA, mostly from patients who are epidemiologically linked to the Indian subcontinent.[6] Several reports from India have shown there is 5-8% prevalence of blaNDM-1, a finding that is somewhat similar to our study findings.[7]
Since all the NDM-1 possessing isolates exhibited high-level of resistance to a different generation cephalo-sporins, it is understood that it may have other genes for multiple antibiotic resistance. Study conducted by Bora and coworkers in 2013 adopted PCR detection for some of the important types of ESBL genes as well as AmpC gene. As expected, each of the blaNDM-1 positive isolate harbored two or more additional blagenes.[8] Of these, blaCTX-M was the most common and found in all isolates, whereas blaTEM was found in 78.57% (11/14) isolates. Only 21.43% (3/14) of NDM-1 producing isolates was positive for plasmid-mediated blaAmpC. However, in our study we did not detect for these genes. Earlier studies from India[9] and abroad,[10] also reported the co-existence of different types of ESBL genes (mostly, blaTEM-1 and blaCTX-M-15) along with AmpC genes (mostly, blaCMY) in blaNDM-1 positive E. coli isolates. The presence ESBL and AmpC genes in the blaNDM-1 positive isolates might contribute to the high level of resistance.
CONCLUSION:
Even though carbapenemase production is rare in E. coli, NDM-1 producing E. coli is now being increasingly reported worldwide. Presence of NDM-1 gene with other resistance determinants on transmissible plasmid constitutes a significant threat to global health‑care for being readily transferable between different clinically relevant bacteria. Therefore, early recognition of NDM-1 producing Enterobacteriaceae, especially E. coli with any reduced carbapenem susceptibility should have primary importance as high mortality rates are associated with patients infected with these bacteria.
ACKNOWLEDGEMENT:
I sincerely thank Dr. Kalyani, Professor and Head, Department of Microbiology, Saveetha Medical College, Chennai for kindly providing the clinical isolates to carry out our research work fruitfully.
REFERENCES:
1. Russo TA, Johnson JR. Proposal for a new inclusive designation for extraintestinal pathogenic isolates of Escherichia coli: ExPEC. J Infect Dis. 181; 2000: 1753-4.
2. Queenan AM, Bush K. Carbapenemases: The versatile beta-lactamases. ClinMicrobiol Rev. 20; 2007: 440-58.
3. Nordmann P, Poirel L, Walsh TR, Livermore DM. The emerging NDM carbapenemases. Trends Microbiol. 19; 2011: 588-95.
4. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk Tests; Approved Standards; Doucement M2- M9 26(9); 2015.
5. Roy S, Singh AK, Viswanathan R, Nandy RK, Basu S. Transmission of imipenem resistance determinants during the course of an outbreak of NDM-1 Escherichia coli in a sick newborn care unit. J Antimicrob Chemother. 66; 2011: 2773-80
6. Nordmann P, Poirel L, Walsh TR, Livermore DM. The emerging NDM Carbapenemases. Trends Microbiol. 19; 2011: 588-95.
7. Deshpande P et al. New Delhi Metallo-beta lactamase (NDM-1) in Enterobacteriaceae: Treatment options with carbapenems compromised. J Assoc Physicians India. 58; 2010:147-9
8. Bora A et al.Incidence of blaNDM-1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol. 31(3); 2013:250-256.
9. Bora A et al.Incidence of blaNDM-1 gene in Escherichia coli isolates at a tertiary care referral hospital in Northeast India. Indian J Med Microbiol. 31; 2013: 250-6.
10. Mulvey MR et al. New Delhi metallo-β-lactamase in Klebsie-llapneumoniae and Escherichia coli, Canada.Emerg Infect Dis. 17; 2011: 103-6.
Received on 23.06.2016 Modified on 30.06.2016
Accepted on 06.07.2016 © RJPT All right reserved
Research J. Pharm. and Tech 2016; 9(11): 1855-1857.
DOI: 10.5958/0974-360X.2016.00378.4