Karrar Saleem Zayed
Department of Laboratory Investigations, Faculty of Science, University of Kufa, Iraq
*Corresponding Author E-mail: karrars.alshebly@uokufa,edu.iq
ABSTRACT:
KRAS gene mutations in codon 12 are detected remarkably in high occurrence in Iraqi patients with colorectal adenocarcinoma. This study aims to investigate the mutations in codon 12 of this gene in colorectal tumor specimens. Fresh biopsies samples were collected from one hundred and twenty colorectal cancer (CRC)patients and one hundred (ulcerative colitis) as non-malignant negative control for revealing mutations in KRAS (codon 12) using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR), mutations were compared between patients and negative control, clinicopathologic features (age, gender, tumor size, grade, stage and tumor site) were compared between mutated and wild-type KRAS in CRC patients. Heterozygous mutations in KRAS codon 12 were significant only in individuals with CRC 52 of 120 (43.33%) when compared with non-malignant control group (ulcerative colitis) 0 (0%) (P<0.001), Odd ratio was 1.765; 95% CI was (1.765-2.202), other CRC patients were present in wild-type homozygotes 68(56.66%). High mean age, well-moderate grade, stage II and recto-sigmoid tumor was significant in association with heterozygous KRAS mutation in codon 12 than homozygous wild-type of CRC patients (P<0.05). Mutation in codon 12 KRAS is regarded as aprognostic marker used for early diagnosis of CRC, also it determines which patient responds to anti-EGFR targeted antibodies treatment.
KEYWORDS: KRAS mutation, codon 12, exon 2, colorectal adenocarcinoma, and RFLP.
INTRODUCTION:
Worldwide, colorectal cancer (CRC) has been a significant cause of death1. CRC is the third most prevalent cancer in both males and females, affecting 3-5% of the population, with an occurrence rate in the age range 50-70 years. About 1.5 million individuals are diagnosed with CRC and approximately 500,000 die from the disease annually .In 2015, CRC represents third of the ten commonest cancers in Iraqi patients 2.
Kirsten-ras (KRAS) is a proto-oncogene situated at 12p12.1, spans about 38 kb, and encodes a p21ras protein with a family contains several binding proteins with GTPase activity.
The normal function of KRAS is signal transduction begins by the binding a ligand like the epidermal growth factor receptor (EGFR) with its receptor3. When the KRAS protein is activated, guanosine triphosphates (GTP) hydrolyze to guanosine diphosphates (GDP) through the turning off signaling pathway. This leading to subsequent conformational change that allows the protein to bind and stimulate approximately twenty downstream effectors like PIK3CA, ERK, mTOR, Braf, Raf, and AKT. These effectors play a vital role for performance the cell functions suchas apoptosis, cell transformation, cell proliferation, differentiation, angiogenesis, and stimulation of cell growth. RAS protein contributes in the transduction of mitogenic signals from the cell membrane to the nucleus 4.
Constitutively, activation of KRAS oncogene mutations occurs at a high ratio in patients with colorectal adenocarcinoma1. Moreover, point mutation activated this gene, resulting in substitutions of single amino acid and the GTPase activity reduced by mutated RAS proteins that cause an alteration in signal transduction5. Approximately 40-50% of CRCs harbor KRASmutations; almost 97% of mutations in KRAS oncogene are limited to codons 12 and 13. The most widely recognized mutations in colorectal adenocarcinoma are point mutations in exon 2 (codon 12) of KRAS gene and the transition mutation of GGT to GAT is the basic change in codon 126. KRAS mutations occur less frequently in codons 63, 61 and 146. Mutations in these three codons result in an activated RAS protein7. Last years, the treatment of this type of cancerhas improved expressively with a new generation of molecularly and chemotherapeutic agents. Various studies have demonstrated that a treatment of this type of cancer with some antibodies such as cetuximab (Erbituxs) or panitumumab (Vectibixs) against epidermal growth factor receptor (EGFR) is applicable just among CRC patients with wild-type KRAS, while a mutant form of this gene has resistance to this type of treatment. KRAS mutation in codon 12 has been as a reliable prognostic analysis independent of the EGFR therapies used8.
It looks that the prevalence of most types of tumorsis increased in Iraq at multi-fold as expected from the exposure to hazardous pollution of last wars against this country. This may reflect some specific mutational patterns in some genes that play an essential role in the occurrence of different kinds of cancers particularly CRC that regarded as the third most prevalent cancer in Iraq according to Iraqi cancer registry. Consequently, because the mutation in KRAS codon 12 is the most promising biomarkers of CRC tumor progression, the purpose of the current study was to evaluate the codon 12 of KRAS gene state in biopsy samples of colorectal adenocarcinoma patients as a predictive marker for this disease.
SUBJECTS AND METHODS:
Subjects:
This work was conducted at the molecular laboratory in the Faculty of Science, University of Kufa, Iraq.100 specimens of fresh biopsies (ulcerative colitis) as non-malignant negative control collected randomly during collection of malignant biopsies with matching age, gender. 120 fresh tumor biopsies from patients with colorectal adenocarcinoma collected from Al-Sader teaching Hospital in Al-Najaf province-Iraq in a period of one year and one month. Each specimen of CRC and ulcerative colitis divided into two parts, the first part fixed in formalin 10% to prepare tissue blocks embedded in paraffin wax for Hematoxylin and Eosin staining and slides were inspected by a pathologist for histopathological assessment of grade, stage, and site of thecolorectal tumor. The second part of the specimen was placed in a container containing normal saline, then transferred to a molecular laboratory for DNA extraction by using Accu Prep® Genomic DNA extraction kit protocol (Bioneer, Korea) in order to use for revealing of KRAS mutation in codon12 of exon 2 by restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR).
Methods:
The mutations in codon 12 of KRAS were screened by RFLP-PCR.100ngof extracted DNA was amplified in a 20 μL of PCR reaction mixture consist of 10 pM of each specific primer:
(formard5ʹACTGAATATAAACTTGTGGTAGTTGGACCT3ʹ) (reverse5ʹTCAAAGAATGGTCCTGGACC-3ʹ), 1 U Taq-polymerase, 1 mM MgCl2, 10 mM of each deoxynucleotide triphosphate (dNTP), Tris-HCl pH: 9, and 0.5KCl (Bioneer, Korea). Denaturation was performed at 95 C for 5 minutes, followed by 40 cycles at 95c for 30 s, at 54 C for 40 s and at 72C for 1 min, with a final elongation step at 72C for 7 min9. Five microliters of each PCR product (157 bp) was digested with 1 U MvaI (BstN1, ThermoScientific, USA) at 60 C for 3 hours. Digestion products were analyzed on 3% agarose gels. The normal homozygous of KRAS is indicated by the presence of one band (114 bp fragment) as a normal allele. While mutant heterozygous of KRAS indicates by presence two bands (143 bp fragment as mutant allele and a 114bp fragment as normal allele).
STATICAL ANALYSIS:
Data have been analyzed by SPSS version 20. Numeric variables were expressed as mean+SE, while nominal variables were expressed as number and percent. Student t-test was used to compare mean between two groups, while Chi-square test was utilized to compare frequencies. Risk estimation was done using odd ratio with 95 % confidence interval. P-value was regarded significant when it was less than or equal to 0.05.
RESULTS:
Features of the study population:
The mean age of CRC adenocarcinoma patients enrolled in the present study was 62.17+ 5.14 years, while in negative control subjects (Ulcerative colitis) was 60.30+4.78 years. Male to female ratio in patients was 1.5:1, however slightly different from that in negative control group 1.3:1, these results assured a coordinated parallel match in mean age and gender between patients and negative control, fulfilling the requirement to conduct such a study. Concerning to tumor size, the mean tumor size in CRC patients was (5.23+0.117) cm.
Most of the patients enrolled in this study exhibited well-moderate differentiation tumor grade, accounting for 82 (68.33%), poor tumor grade found in 38 (31.66%) of patients. Regarding tumor stage, the majority of patients had stage 1, 60 (50%), stage 2 was founded in 50 (41.66%) but stage 3 was seen in 10 (8.33%).The majority of CRC was found in recto-sigmoid site 54 (45%), sigmoid site accounting for 30 (25%), left and right colonic sites were seen in 26 (21.66%) and 10(8.33%) of patients respectively as shown in (Table 1).
Table(1):Clinicopathologic features of CRC patients:
|
Clinicopathologic features |
CRC patients |
|
|
|
(%) |
No. |
|
Grade |
||
|
Well-Moderate |
68.33 |
82 |
|
Poor |
31.66 |
38 |
|
Stage |
||
|
Stage1 |
50 |
60 |
|
Stage2 |
41.66 |
50 |
|
Stage3 |
8.33 |
10 |
|
Tumor site |
|
|
|
Recto-sigmoid |
45 |
54 |
|
Sigmoid |
25 |
30 |
|
Left colonic |
21.66 |
26 |
|
Right colonic |
8.33 |
10 |
KRAS mutations in (codon12) in CRC patients:
Firstly, exon 2 in the KRAS gene detected in all samples (negative control and CRC patients) enrolled in this study by PCR to ensure the existence of the exon2 in the KRAS gene(Figure 1).
Then, detecting of a mutation in codon 12 of the KRAS in CRC patients by RFLP-PCR (Figure 2). The rate of mutation (Heterozygous genotype) in codon 12 of KRAS was significant exclusively in CRC patient group 52(43.33%) when compared with non-malignant negative control group (ulcerative colitis) 0 (0%) (Homozygous wild type) (P<0.001), Odd ratio was 1.765; 95% CI was (1.765-2.202), while 68(56.66%) of the CRC patients were homozygous wild-type as shown in (Table 2).
Table(2):. Comparison of KRAS mutation in (codon12) between negativecontrol and patient groups
|
|
|
Negative Control (n=100) |
Patients (n=120) |
|
|
95 % CI† |
|||
|
Gene |
Mutation |
No. |
% |
No. |
% |
P-value |
Odd ratio* |
Lower |
Upper |
|
KRAS Exon 2 (codon 12) |
Positive (Heterozygous) |
0 |
0.00 |
52 |
43.33 |
<0.001 |
1.765 |
1.414 |
2.202 |
|
Negative (Homozygous) |
100 |
100.0 |
68 |
56.66 |
|||||
* Odd ratio; † Confidence interval
Table(3): Association between KRAS mutation in codon12 and mean age, mean tumor size
|
|
Negative mutation (Homozygous ) |
Positive mutation (Heterozygous) |
|
||||
|
Parameters |
No. |
Mean |
+SE |
No. |
Mean |
+SE |
P-value |
|
Age (years) |
68 |
58.41 |
1.360 |
52 |
67.08 |
1.060 |
<0.001 |
|
Tumor size (cm) |
68 |
5.15 |
0.141 |
52 |
5.35 |
0.200 |
0.405 |
SE: Stander Error
Table(4): Association between clinicopathologic parameters (gender, grade, stage, tumor site) and KRAS mutation
|
Parameters |
Negative mutation (Homozygous) |
Positive mutation (Heterozygous) |
|
|||
|
|
No. |
% |
No. |
% |
P-value |
|
|
Gender |
Male |
38 |
52.8 |
34 |
47.2 |
0.457 |
|
Female |
30 |
62.5 |
18 |
37.5 |
||
|
Grade |
Well-moderate |
38 |
46.3 |
44 |
53.7 |
0.018 |
|
Poor |
30 |
78.9 |
8 |
21.1 |
||
|
Stage |
Stage 1 |
44 |
73.3 |
16 |
26.7 |
0.034 |
|
Stage 2 |
20 |
40.0 |
30 |
60.0 |
||
|
Stage 3 |
4 |
40.0 |
6 |
60.0 |
||
|
Tumor site |
Recto-sigmoid |
20 |
37.0 |
34 |
63.0 |
0.043 |
|
Sigmoid |
20 |
66.7 |
10 |
33.3 |
||
|
Left-colonic |
20 |
76.9 |
6 |
23.1 |
||
|
|
Right-colonic |
8 |
80.0 |
2 |
20.0 |
|
Figure (1): Agarose gel (1%) electrophoresis image shows the PCR product analysis of KRAS gene (exon2) from CRC patient and negative control. Where M: Marker (100bp) DNA ladder. Lane (1,2): control sample. Lane (3-10): CRC patient samples. For all lanes the size of products was 157bp.
Figure (2): Agarose gel (3%) electrophoresis image shows the RFLP-PCR product analysis of 157bp PCR products KRAS gene exon2(codon12) in CRC patients and negative control that digestion by MvaI (BstN1) restriction endonuclease, where M: Marker (2000-100bp). Lanes (1-3,6): Homozygous patients represented by the 114bp band .Lanes (4,5,7): Heterozygous patients represented by the143bp band (mutant allele) and 114bp band (normal allele), Lanes (8): Homozygous control represented by the 114bp band. (The 114bp fragment indicates the normal KRAS while the 143bp fragment indicates the mutant KRAS codon 12 allele).
In a comparison of mean age in CRC patients, the results reveal that mean age of patients with positive KRAS mutation was significantly higher than patients with negative mutation (67.08+1.060 Vs. 58.41+1.360 years) (P<0.001). Whileregarding mean tumor size, there was no significant association between mutant KRAS and non-mutant KRAS (P =0.405), as illustrated in (Table 3).
The results also showed there is a significant association between positive KRAS mutation in CRC patients and well-moderate differentiation grade than poor differentiation grade (P=0.018). As for the tumor stage, stage 2 showed significant association with positive KRAS mutation than stage 1 and stage 3 (P=0.034).
Concerning the tumor site, the recto-sigmoid tumor indicates a significant correlation with patients who have KRAS heterozygous mutant genotype (P=0.043) in comparison with other tumor sites (sigmoid, left-colonic and right-colonic). Also, this result demonstrated there was no significant difference between male and female in positive KRAS as shown in (Table 4).
DISCUSSION:
Point mutations in KRAS oncogene at codons 12, 13, or 61 regarded as an early event in the pathogenesis of sporadic CRC is, these mutations can be recognized in around 40–50% of these tumor lesions. The majority of these mutations are located at codon12 while in other codons are less frequent10.Mutation in this codon is identified at a strikingly high occurrence in colorectal adenocarcinoma and is regarded to be a crucial change in the oncogenesis of this cancer. The most common change in codon 12 is a transition of GGT to GAT. Because KRAS mutations are typically detected at these codons, particular and sensitive diagnostic methods have been developed for identifying KRAS mutant alleles in body fluids and tissues of CRC patients. Furthermore, analysis of mutations in the codon 12 of this gene is now well known as a prognostic biomarker for detection a patient with CRC, the clinical experiments have revealed that only CRC case with wild-type KRAS gene status responds to treatment with EGFR. On the other hand, the analysis of KRAS mutational status has been correlated with low response ratio to different chemotherapeutic drugs, especially EGFR, since, KRAS mutations is a decisive marker when considering the use of targeted therapies 11.
The current results revealed the mean age of CRC patients is (62.17+ 5.14) years. It has been documented by many researchers that the majority of CRC cases become clinically evident after the age of 56 years12. These results are in accordance with the result of the present study. One can ask that: why does CRC affect elderly people more frequently than young age subjects? This advanced age at the time of presentation signifies the environmental role in the pathogenesis of this cancer, namely the accumulative effect of toxicity and oxidative agents, also the environmental hazard may cause a relative defect in DNA repair mechanisms related to advanced ages 13. In our opinion, there should be something common, regarding environmental exposure, to be blamed, as an important hazard for influencing the age-related promotion of mutated cells in the pathway of the multi-step theory of the development of cancer. In the present study, the proportion of male to female is 1.5:1 (Table 1). Aykan et al. documented that CRC is slightly more frequent in male than female, about 1.5:1 14. One of the hypotheses suggested answering why the CRC more common in males than females is that females have estrogenic hormonal levels much more than that owned by males. If this is true, how does estrogen protect again colorectal cancer? Hartman and Gustafsson concluded that female hormones (estrogens) are an essential factor in protecting of females against initiation and progression of CRC and that the protective effect most likely is interceded by estrogen receptor β (ERβ) 15.
The current study showed that the majority of CRC (68.33%) had a well-moderate differentiated grade histological pattern in comparison with poorly differentiated grade (31.66%)(Table 1).The frequent malignant tumor of the large bowel is a well-to-moderately differentiated adenocarcinoma secreting different amounts of mucin16. Qasim et.al. reported that the majority of CRC cases (64%) were well to moderately differentiated lesions22. This result is similar to the result of the present study .This study also highlights that most of the patients enrolled in the current study had an early stage (stage I ,II) of CRC disease (50%,41%) (Table 1). This finding has been identified in another study17. Regardingthe tumor site, this study showed that 45% of tumor masses were located in the recto-sigmoid region and 25% of cases were located in the sigmoid region, while 21.66% and 8.33% of tumor masses were found in left and right colonic regions respectively. Aykan et al. 14found the recto-sigmoid tumor is the most region in the colorectal canal that contains malignant tumor, so they consistent with the result of this study. The median colorectal tumor size of most cases presented in this study is (5.23+0.117) cm. Another study doesn't differ from the result of the current study mention that the median size of CRC tumors was ranging from (4.5-5.4) cm 18.
The current study revealed that KRAS mutation in patients with CRC was significantly higher in (codon12) exon2 (43.33%) (P<0.001) in comparison with negative control (ulcerative colitis) (0%) while other patients (56.66%) were wild type KRAS mutation in codon 12 (Table 2)(Figure2).Chretien et al. have reported the incidence of KRAS mutation inexon 2 (codon 12)for CRC patients was 44.2%19.Dobre et al. showed that the rate of KRAS (codon 12) mutation in CRC patients was 46.4%20.Also,another study in CRC patients reported that the percentage of mutation in this codon was 45.3%21.Similar findings have been observed by several researchers revealing that the mutation in codon12 was significant in CRC patients compared with the negative control group17.All these results were in accordance with the result of the present study and they were an approach to the percentage of mutation in the current study with as light difference because of the heterogeneity of hereditary anomalies in tumors and the racial diversity.
Normally, KRAS protein exists in an inactive status in any cell. KRAS be activated when a transmembrane receptor such as (Toll-like receptors and growth factor receptors) is bind with its relating ligand. Accordingly, the intracellular signal cascade includes guanine exchange factors (GEF) activated KRAS gene by substituting the inactive GDP with GTP. Once activation of KRAS, it prompts the downstream activation of a variety of effectors like phosphoinositide 3-kinase (PI3K), GTPase-activating proteins (GAPs), and serine/threonine kinases. When the GTP is changed back to a GDP, KRAS is deactivated 4. If the mutations occur in KRAS gene, it stays in the GTP status. Thus, this gene remains in a constitutive GTP-bound status and, therefore, control of downstream activities is lost. Mutations in KRAS are closely correlated with impairing GTPase function and leaving G protein in its active state. So, this mutation makes the KRAS proteins insensitive to GTP-induced hydrolysis of GTP to GDP and lock them in the activated status what results in uncontrolled cell division and excessive it as well as a derangement in their differentiation 22.
Specifically, DNA nucleotide mutations in codon 12 of KRAS including G→T or G→A, which result in a replace the glycine amino acid in the first or second position of codon 12. The existence of a glycine residue in this codon regarded as a significant factor to perform the normal function of KRAS protein. Consequently, substitutions of single base lead to a change of the glycine to valine in codon 12 and formation of GTPases that are locked in the “on” position. Thus, changing the spatial conformation of RAS, leading to a constitutively activated form where the RAS signaling cascade to other participants occurs regardless of EGFR status. This explains the predictive importance of KRAS mutations in determining any of the CRC patients responding to anti-EGFR therapy and which one does not respond23. The induction of these different point mutations in KRAS has been attributed to ethnic variation and various dietary components24. It has been proposed that G→A transitions may happen spontaneously as a result of mistakes in replication of DNA, this type of mutation may be stimulated by alkylating agents possibly resulting from the diet, while G→T transversions could be produced from environmental carcinogens and dietary mutagens25. Different prevalent environmental carcinogens are known to cause G→T transversion and stimulating codon 12 mutationsin CRC patients, these carcinogens including heterocyclic amines and polycyclic aromatic hydrocarbons 13.
The relationship between KRAS mutation in codon 12and the clinicopathologic parameters of CRC has been extensively investigated. Regarding the relation between the age of patients and KRAS mutation in codon 12 of exon 2, this study showed that the mutation in this codon increased significantly (P<0.001) in a higher mean age of patients (67.08+1.060) years in comparison with mean ages of patients with KRAS wild-type(58.41+1.360) years (Table 3). This result is consistent with another study that revealed the KRAS mutation in codon 12 increased with higher ages of CRC patients 26. In controversy to this finding, another study has reported there is no correlation between age of CRC patients and KRAS mutation in codon 12 27.The mutations in the genes rendering colonic mucosa malignant are the result of environmental factors, namely the interaction between products of food digestion and micro-organisms in the colonic mucosa. So, a long period of time is needed for multiple genes to undergo mutation by the effect of chemical carcinogens on the colonic mucosa before the appearance of frank malignancy, explaining the old age of the majority of patients. The relationship between advanced ages of CRC patients and KRAS mutation may be represented by accumulation of ROS, which result from environmental hazards and radiation that hurt the KRAS gene in epithelial cells of colon and rectum that responsible for growth and proliferation of cells which causes develop more mutations increased with advanced ages of CRC patients 26.Military radiation as a cause of CRC has been investigated by Kaiser et.al who proved an association between radiation exposure and predisposition to colorectal carcinoma28.Busby et.al observed an increased incidence of birth defects and cancers that were attributed to depleted uranium usage in Iraq because this country exposed to this dangerous chemical during the first and second Gulf War 29.
With regards to median tumor size and gender of patients, this study showed that the median colorectal tumor size of most patients with positive KRAS mutation in codon 12 was(5.35+0.200 cm) while this median size was (5.15+0.141 cm) in patients with negative mutation, the difference between these two median tumor sizeswere not significant (Table 3). Also, there was no significant difference between male and female patients with apositive mutation of this gene (Table 4).Other studies don’t differ from the results of the current study about tumor size and gender30.
This study also exhibited that a significant relation between KRAS mutation and both well-moderate differentiation CRC and stage 2 (Table 4). Some studies are in agreement with the present study with regards to the correlation of tumor grade and stage with KRAS mutation in codon 12,these studies have concluded that a mutation in codon 12 of this gene was more generally found in well to moderately differentiated CRCs 31,32 and it was associated with stage2 than other stages 9,33.This aspect of well-moderate differentiation(low grade) predominance may reflect the broad spectrum of molecular genetics subsets of CRC, as the low grade tumors have some genetic mutations, particularly in the KRAS gene, differ from that of high grade 33. The low grade may take time to be transformed to high grade and this gives a good opportunity for early diagnosis. KRAS mutation in stage 2 of CRC associated with the good outcome of CRC, as the tumor cells are confined to the mucosa and submucosa without muscle invasion and this gives a good chance for successive treatment30.We can conclude that mutation of KRAS codon 12 has an important and an essential role in early steps of the pathogenesis of low grade, early stage CRC and can be regarded as an early predictor, in addition, to being a good prognostic marker for CRC used as EGFR targeted therapies for CRC patients with KRAS suffers from this mutation.
The recto-sigmoid tumor is correlated significantly with KRAS mutation in codon 12 rather than other tumor sites (Table 4).This conforms to another study which showed the same result of this study10. The important question, why does the majority of colonic tumors involve the rectum and sigmoid region? To answer this question one should refer to the proposed pathogenesis of colorectal carcinoma. It is now established that the majority of these malignant tumors arises from premalignant precursors named adenoma. Adenomas in the colon are classified into three main types: tubular, villous and tubule-villous adenomas .Villous adenomas are the main type that progress to adenocarcinoma through multistep genetic and epigenetic mutations. Villous adenomas are more frequently found in the rectum and sigmoid region than other parts of the colon and as they represent the precursor lesions for adenocarcinoma, this explains the fact that the majority of colonic cancers involve the recto-sigmoid region 34.
CONCLUSION:
Analysis of KRAScodon 12 mutation is a good biomarker in patients with colorectal adenocarcinoma has prognostic value for early detection of this cancer. It will help the patients to the choice of adjuvant therapy (anti-EGFR targeted antibodies) because this mutation correlated with decreased responses to these chemotherapeutic agents while wild-type KRAS response to treatment.
ACKNOWLEDGEMENTS:
The author is thankful to the Al-Sadr teaching hospital for providing some of the requirement for this study.
ETHICS STATEMENT:
All procedures conducted in this study (including human participants) were inconsistent with the ethical standards of the Iraqi IRP.
REFERENCES:
1. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics. CA: Cancer J Clin. 55(2); 2002:74-108.
2. Brenner H, Kloor M, Pox CP. Colorectal cancer. Lancet. 383 (9927); 2014: 1490-502.
3. Malumbres M, Barbacid M. RAS oncogenes: the first 30 years. Nat Rev Cancer. 3(6); 2003: 459-465.
4. Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer. 3(1); 2003: 11-22.
5. Tang W, Elnatan J, Lee Y, Goh H, Smith D. c-Ki-ras mutations in colorectal adenocarcinomas from a country with a rapidly changing colorectal cancer incidence. Brit J Cancer. 81(2); 1999: 237.
6. Imamura Y, Morikawa T, Liao X, Lochhead P, Kuchiba A, Yamauchi M, Qian ZR, Nishihara R, Meyerhardt JA, Haigis KM. Specific mutations in KRAS codons 12 and 13, and patient prognosis in 1075 BRAF wild-type colorectal cancers. Clin Cancer Res. 18(17); 2012: 4753-4763.
7. Li Z, Chen Y, Wang D, Wang G, He L, Suo J. Detection of KRAS mutations and their associations with clinicopathological features and survival in Chinese colorectal cancer patients. J Int Med Res 40(4); 2012:1589-1598.
8. Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 487(7407); 2012: 330-337.
9. Suehiro Y, Wong CW, Chirieac LR, Kondo Y, Shen L, Webb CR, Chan YW, Chan AS, Chan TL, Wu T-T. Epigenetic-genetic interactions in the APC/WNT, RAS/RAF, and P53 pathways in colorectal carcinoma. Clin Cancer Res. 14(9); 2008:2560-2569.
10. Vaughn CP, ZoBell SD, Furtado LV, Baker CL, Samowitz WS. Frequency of KRAS, BRAF, and NRAS mutations in colorectal cancer. Genes, Chromosomes and Cancer. 50(5); 2011: 307-312.
11. Siddiqui AD, Piperdi B. KRAS mutation in colon cancer: a marker of resistance to EGFR-I therapy. Ann SurgOncol. 17(4); 2010: 1168-1176.
12. Lanthaler AJ, Spizzo G, Mitterer M, Mian C, Mazzoleni G. Interlaboratory comparison of K-ras testing by real-time PCR and RFLP in colorectal cancer samples. DiagMolPathol. 20(2); 2011: 90-93.
13. Brown K, Buchmann A, Balmain A. Carcinogen-induced mutations in the mouse c-Ha-ras gene provide evidence of multiple pathways for tumor progression. ProcNatlAcad Sci. 87(2); 1990:538-542.
14. Aykan NF, Yalçın S, Turhal NS, Özdoğan M, Demir G, Özkan M, Yaren A, Camcı C, Akbulut H, Artaç1 M. Epidemiology of colorectal cancer in Turkey: A cross-sectional disease registry study (A Turkish Oncology Group trial). Turk J Gastroenterol. 26; 2015:145-153.
15. Hartman J, Gustafsson J-Ĺ. Estrogen receptors in colorectal cancer: goalkeepers, strikers, or bystanders? Cancer Prev Res. 3(8); 2010:897-899.
16. Qasim BJ, Ali HH, Hussein AG: Immunohistochemical expression of PCNA and CD34 in colorectal adenomas and carcinomas using specified automated cellular image analysis system: A clinicopathologic study. Saudi J gastroenterol: official journal of the Saudi Gastroenterology Association. 18(4); 2012:268.
17. Arrington AK, Heinrich EL, Lee W, Duldulao M, Patel S, Sanchez J, Garcia-Aguilar J, Kim J. Prognostic and predictive roles of KRAS mutation in colorectal cancer. Int J MolSci. 13(10); 2012: 12153-12168.
18. Kornprat P, Pollheimer MJ, Lindtner RA, Schlemmer A, Rehak P, Langner C. Value of tumor size as a prognostic variable in colorectal cancer: a critical reappraisal. Am J Clin Oncol. 34(1); 2011:43-49.
19. Chretien AS, Harlé A, Meyer‐Lefebvre M, Rouyer M, Husson M, Ramacci C, Harter V, Genin P, Leroux A, Merlin JL. Optimization of routine KRAS mutation PCR‐based testing procedure for rational individualized first‐line‐targeted therapy selection in metastatic colorectal cancer. Cancer Med. 2(1); 2013:11-20.
20. Dobre M, Comănescu M, Arsene D, Iosif C, Bussolati G. K-ras gene mutation status in colorectal cancer: comparative analysis of pyrosequencing and PCR-RFLP. Rom J MorpholEmbryol 54(3); 2013:567-574.
21. Dinu D, Dobre M, Panaitescu E, Bîrlă R, Iosif C, Hoara P, Caragui A, Boeriu M, Constantinoiu S, Ardeleanu C. Prognostic significance of KRAS gene mutations in colorectal cancer-preliminary study. J Med Life.7(4); 2014: 581.
22. Schubbert S, Shannon K, Bollag G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer. 7(4); 2007:295-308.
23. Heinemann V, Stintzing S, Kirchner T, Boeck S, Jung A. Clinical relevance of EGFR-and KRAS-status in colorectal cancer patients treated with monoclonal antibodies directed against the EGFR. Cancer Treat Rev. 35(3); 2009:262-271.
24. Urošević N, Dujić A, Krtolica K, Škaro‐Milić A, Knežević‐Ušaj S. Prevalence of G‐TO‐T transversions among K‐ras oncogene mutations in human colorectal tumors in Yugoslavia. Int J Cancer. 54(2); 1993:249-254.
25. Zarbl H, Sukumar S, Arthur AV, Martin-Zanca D, Barbacid M.Direct mutagenesis of Ha-ras-1 oncogenes by N-nitroso-N-methylurea during initiation of mammary carcinogenesis in rats. Nature. 315(6018); 1985: 382-385.
26. Zhunussova G, Djansugurova L, Khussainova E, Zhunusbekova B, Afonin G, Khaidarova D, Matejcic M, Parker MI. K-ras codon 12 and not TP53 mutations are predominant in advanced colorectal cancers. SAMJ: S Afr Med J. 105(8); 2015: 670-674.
27. Zlobec I, Bihl MP, Schwarb H, Terracciano L, Lugli A. Clinicopathological and protein characterization of BRAF‐and K‐RAS‐mutated colorectal cancer and implications for prognosis. Int J Cancer. 127(2); 2010: 367-380.
28. Kaiser JC, Meckbach R, Jacob P. Genomic instability and radiation risk in molecular pathways to colon cancer. PloS one. 9(10); 2014:e111024.
29. Busby C, Hamdan M, Ariabi E. Cancer, infant mortality and birth sex-ratio in Fallujah, Iraq 2005–2009. Int J Environ Res Public Health. 7(7); 2010: 2828-2837.
30. Wu C-M, Tang R, Wang J-Y, Changchien C-R, Hsieh L-L. Frequency and spectrum of K-RAS codons 12 and 13 mutations in colorectal adenocarcinomas from Taiwan. Cancer Genet Cytogenet. 158(1); 2005: 55-60.
31. Kawabata Y, Tomita N, Monden T, Ohue M, Ohnishi T, Sasaki M, Sekimoto M, Sakita I, Tamaki Y, Takahashi J. Molecular characteristics of poorly differentiated adenocarcinoma and signet‐ring‐cell carcinoma of colorectum. Int J Cancer. 84(1); 1999:33-38.
32. Poehlmann A, Kuester D, Meyer F, Lippert H, Roessner A, Schneider-Stock R. K-ras mutation detection in colorectal cancer using the Pyrosequencing technique. Pathol Res Pract. 203(7); 2007:489-497.
33. Bazan V, Migliavacca M, Zanna I, Tubiolo C, Grassi N, Latteri M, La Farina M, Albanese I, Dardanoni G, Salerno S. Specific codon 13 K-ras mutations are predictive of clinical outcome in colorectal cancer patients, whereas codon 12 K-ras mutations are associated with mucinous histotype. Ann Oncol. 13(9); 2002: 1438-1446.
34. Migliore L, Migheli F, Spisni R, Coppedč F. Genetics, cytogenetics, and epigenetics of colorectal cancer. BioMed Res Int, 2011.
Received on 09.10.2017 Modified on 17.11.2017
Accepted on 20.12.2017 © RJPT All right reserved
Research J. Pharm. and Tech. 2018; 11(3): 1041-1047.
DOI: 10.5958/0974-360X.2018.00195.6