INTRODUCTION:

The proliferation of cells is the first step in establishing a tissue culture procedure. In general, a small number of cells can be obtained from a primary source. These cells need to be expanded up to a certain magnitude to make them viable for different ex vivo studies. The cells rapidly lose their specific function after they are isolated from their origin. This would be a limitation for drug-screening and other studies. Thus, for a wide range of biology applications, it is important to culture the cell for long periods of time^[1].

In natural conditions in vivo cells are surrounded by a complex three-dimensional network provided by the extracellular matrix and other neighbouring cells^[2]. These cells are also well connected by a complex network of capillaries to provide nutrients and to remove the waste materials^[3]. A scaffold which can mimic these in vivo conditions will be beneficial in maintaining the cells ex vivo. Scaffolds play an important role in growth and proliferation of cells, as they provide extended supports to cells compare to 2D culture. Apart from structural framework scaffolds are also plays a vital role in targeted delivery of cells, DNA, drug etc. into respected sites^[4-5].

Acetaminophen (APAP, paracetamol), also commonly known as Tylenol, is the most commonly taken analgesic worldwide. It is also used for its antipyretic effects, helping to reduce fever^[6-7]. Acute doses of APAP can induce different cytotoxic mechanisms and morphological changes in different liver cell lines^[8]. It can induce caspase-dependent apoptosis on hepatoma Huh-7 and SK‑Hep1 cells and induces apoptosis and necrosis on hepatoma HepG2 cells and Hep3B cells^[9-11]. Most knowledge of APAP-induced liver injury has been obtained in studies on rodents^[12]. However, differences in the pathogenesis of APAP-induced hepatotoxicity between rodents and humans appear to be considerable ^[13]. To address the limitations of animal models of APAP-induced hepatotoxicity, a human in vitro system may be useful. Huh-7 and human HCC have been proposed as an alternative to primary human hepatocytes for in vitro models of normal liver cells. The potential advantages of hepatoma cells are that, as an immortalized cell line, they are readily available in large quantities, they are easy to maintain because they can be cryopreserved, and their drug-metabolizing enzyme activities do not decrease in cultivation, as happens in primary cultures of human hepatocytes ^[14]. But the major disadvantage is that the mechanisms underlying drug metabolism and toxicity may be abnormal in transformed cells. Despite these issues, the hepatoma cell lines are used widely in studies of liver function, metabolism, and drug toxicity. They also possess many of the biochemical and morphological characteristics of normal hepatocytes and hence they are widely used in studies related to toxicity by drugs ^[15]. Many reports have demonstrated that the micro-space cell culture plate method, a three-dimensional (3D) culture system, can induce hepatocyte-specific functions, including CYP2E1 expression, in HepG2 cells, which results in an increase in cytotoxicity by acetaminophen compared with a conventional two-dimensional (2D) culture system ^[16]. These results suggest that 3D-cultured HCC cells may be a useful tool as an in vitro human model of APAP-induced hepatotoxicity. Other studies have reported on a new 3D-cultured HepG2 system using a nano culture plate (NCP) that shows higher expression of albumin and some CYP enzymes in NCP-cultured hepatoma cells compared with conventionally cultured cells ^[17]. .However, it remains to be demonstrated whether cell injury induced by APAP in 3D-cultured HCC in vitro was produced by corresponding human and rodent mechanisms of in vivo APAP-induced hepatotoxicity and if antidotes such as N-acetylcysteine (NAC) or other agents also show protective potential against APAP-induced hepatotoxicity in the 3D-cultivation system ^[18-19].

The present works involve setting up a scaffold-based cell culture system and then studying its influence on gene expression of drug-metabolizing enzymes. Hydrogels, and many other materials are widely used in tissue engineering as scaffolding materials and many scaffold making techniques are available^[20]. In this work, we have fabricated polydimethylsiloxane (PDMS) scaffolds, PDMS is a silicone polymer that is biocompatible and has high permeability for gases. Furthermore, PDMS structures are easy and inexpensive to manufacture. PDMS is widely used in electronic drug delivery systems^[21-22]. This study was conducted to gain insight into 3D-cultured Huh-7 cells as a human system and to study APAP-induced hepatotoxicity. We evaluated whether 3D-cultured Huh-7 cells by using PDMS scaffolds demonstrate any distinctive mechanistic characteristics such as, a) higher sensitivity against APAP-induced cell injury compared with conventionally cultured cells and b) higher expression of mRNA levels of cytochrome P450 2E1, which metabolizes APAP to a toxic metabolite.

MATERIALS AND METHODS:

Chemicals and materials:

Acetaminophen (> 99%), purchased from Sigma–Aldrich, PDMS (SYLGARD™ 184 Silicone Elastomer Kit).3

Cell culture:

Huh-7 cells were cultured in Dulbecco's modified Eagle's medium-high glucose (DMEM, Sigma–Aldrich) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Thermo Scientific, North American origin) and antibiotics penicillin-streptomycin powder (Hi-Media) 0.4µg/ml final concentration. The cells were cultured at 37°C, 95% relative humidity and 5% CO₂. Cells from an 80% confluent dish were taken for experiments. Confluent cultures were washed with phosphate-buffered saline (PBS), pH 7.4, detached with trypsin, centrifuged, and sub-cultured. In the conventionally cultured group, Huh-7 cells were seeded with 1ml culture medium in 12-well plates. In contrast, 12-well plates with scaffolds incorporated were used in the scaffold-cultured group, and the cells were seeded at the same density compared with the conventionally cultured group.

Scaffold design and fabrication:

A hexagonal template of side 20µm, with a height of 50µm, was fabricated out of silicon using Deep Reactive Ion Etching (DRIE) and the moulds were cast out of polydimethylsiloxane (PDMS) from this template. Each hexagon has two microchannels (width 3µm) one on each side of the opposite hexagon, connecting the adjacent two hexagons for enhanced perfusion of the nutrients. The hexagonal design was chosen to mimic in vivo architecture of liver cells. The detail of the scaffold fabrication process is as shown in Fig 1.

Fig 1: Microfabrication process flow of silicon-based mould

Processing scaffolds for cell culture:

PDMS scaffolds were cut out using a circular punch of 18mm and then stuck to cleaned coverslips using a drop of PDMS. This is followed by ultra-sonicate washing in 70% alcohol and two washes with de-ionized water for 15min each. Scaffolds are further subjected to steam sterilization by autoclaving. The scaffolds were next stuck to the bottom of the 12-well plates or 60mm culture dishes depending on the experiment and then coated with collagen by adding 700µl of 30µg/ml of Type I collagen (Rat Tail – Gibco by Life Technologies) for 4h at 37^oC to aid cell attachment. Excess collagen is removed from the culture wells/dishes by washing with PBS prior to cells seeding.

Immunostaining and fluorescence microscopy:

Scaffolds were fixed in 4% paraformaldehyde for ten minutes at room temperature after culturing, at day 3 and day 7 followed by permeabilization with 0.5% TritonX-100 for 10min at 37°C. Actin filaments were stained with rhodamine-phalloidin (Molecular Probes) for 20min at 37^◦C, and Nucleus was stained with DAPI (4,6-diamidino-2-phenylindole, dihydrochloride) (Molecular Probes) for 10min at 37°C. Images were acquired with a TCS SP5 II confocal microscope. Scaffolds were fixed in 4% paraformaldehyde for 10min at room temperature after 72h of culture, followed by permeabilization with 0.5% TritonX-100 for 10min at 37^oC. Nucleus was stained with DAPI (4,6-diamidino-2-phenylindole, dihydrochloride) (Molecular Probes) for 10min at 37°C. Images were acquired with a Leica AF 6000 inverted microscope series in case APAP treated experiments.

Growing Huh-7 cells and RNA isolation.

Around 80,000 Huh-7 cells were seeded in scaffolds and controls (12 well plates with plain PDMS sheets). Before cell seeding the coverslip containing the scaffold were processed for cell culture further coated with collagen by immersing it in a solution of 30µg/ml of Type I collagen (Rat Tail – Gibco byltur Life Technologies) for 4h at 37^oC to aid cell attachment. The RNA is isolated on day 3 and day 7 from the day of culture and with control samples using RNase mini kit (Qiagen) as per the manufacturer's instruction. A total of 0.5-2µg of RNA was used for cDNA synthesis using a high-capacity cDNA reverse transcription kit (Applied Biosystems) as per the manufacturer's instruction. Quantitative real-time PCR (qRT-PCR) was carried out using Power up SYBR Green master mix (Thermo Scientific) with 10ng of the cDNA as a template. Gene expression was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Fold change was calculated using 2^-∆∆ct. Drug-metabolizing gene markers primers namely phase I (CYP1A2, 2B6, 2C9, 2D6, 2E1, 3A4) and phase II (UGT1A1,1A6) xenobiotic-metabolizing enzymes, nuclear receptors (CAR, PXR) and the liver marker albumin (Alb) were used for gene expression study.

^{Cytotoxicity and cell viability Assay}

MTT [3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay^[23] was performed to determine the cytotoxicity levels of APAP. Huh-7 cells were taken from an 80% confluent flask. Cells were trypsinized and approximately 5000 cells in 200µl medium per well were plated in 96-well plate. After 24h of incubation, cells were treated with different concentrations of APAP and incubated for 48h. After the incubation period, drug and medium were pipetted out from the wells. MTT reagent was added and incubated for 4h. The MTT reagent was removed and DMSO added to dissolve the formazan formed in live cells. Absorbance at 570nm was measured using a Micro-plate reader. The results were produced from independent experiments, and each experiment was performed in triplicate for each cell line. The concentration required for a 50% inhibition of viability (IC₅₀) was determined graphically. The effect of the samples on the proliferation of cell lines was expressed as the % cell viability, using the following formula:

% of cell viability = Absorbance of treated cells/Absorbance of control cells x 100 (1)

% of cell inhibition = 100 – % of cell viability (2)

A similar procedure was followed for scaffolds in 12-well plates as it is very difficult to incorporate PDMS scaffolds into 96-well plates.

DNA quantification:

After 24h of cell attachment in 12 well plates with and without scaffolds. The wells are treated with and 10mM (Huh-7) APAP for 48h except for control wells. The proliferation of the cells in control and treated conditions was evaluated by measuring the cellular DNA content using Picogreen dsDNA quantification kit (Invitrogen), as described recently^[24]. Briefly, cells were lysed using lysis buffer (0.02% SDS with Proteinase K 0.2mg/ml). The lysate was mixed with the picogreen dye to determine DNA content by measuring the fluorescence intensity in a plate reader with 485nm excitation and 528nm emission.

RESULTS:

SEM images of PDMS scaffolds:

Fig 2 shows the scanning electron microscopic images of the PDMS scaffolds were fabricated out of silicon using DRIE and moulds were cast out of PDMS from this template. Each hexagon has six microchannels (width 3µm) one on each side of the hexagon, connecting the adjacent six hexagons for enhanced perfusion of nutrients.

Fig 2. SEM images of PDMS scaffolds (a) Enlarged view of the hexagonal template (b) Array of hexagonal (c) 50µm height scaffold (d) Top view of 50µm height scaffolds

Immunostaining and fluorescence microscopy:

The projection of one unit of the scaffold for each case (Day 3, Day 7 cultures) and one cross-section view (the section is along the yellow line and the view is along with the arrows) are showed in Fig 3. From the cross-section image, it can be observed whether the cells are along the walls of the scaffold or growing inside it on the coverslip. All the scale bars are 30μm and the projection technique used is ‘sum’.

Fig 3. Confocal images of Huh-7 cells stained for the nucleus (green) and actin (magenta) of Day 3 and Day 7 scaffold cultures.

Cell morphology:

Fig 4a, 4b represents Huh-7 cells cultured on 50µm PDMS scaffolds for 72h respectively. In conventionally cultured cells, cells have adhered to the bottom of the plate whereas in PDMS scaffold culture cells were aggregated and grow in clumps.

Fig 4: Cell morphology on scaffolds a). Bright-field image of Huh-7 cells grown on 50 µm scaffolds. b). Huh-7 cells stained for nucleus with DAPI on 50µm scaffolds

^{Cytotoxicity and cell viability assay:}

We compared the effects of APAP on cell viability on Huh-7 cells 48h after APAP exposure in conventionally cultured groups. The results revealed that a dose-dependent exposure of APAP on Huh-7 cell lines (Fig. 5), 50% of cells were viable at 10mM concentration of APAP cells on Huh-7 cells.

Huh-7 cell lines grown on PDMS scaffolds were subjected to three (10mM, 15mM, 20mM) different concentrations of APAP for 48h and cytotoxicity (MTT) were performed on scaffold cultured cells. Fig. 6 shows, there was a difference in the percentage of cell viability in Huh-7 cell lines between two types of cultures. Cell viability was slightly but significantly different between the two-culture systems i.e., Conventional monolayer cultures and PDMS scaffold cultures. Cells grown in the presence of scaffolds showed slightly lower cell viability than with a conventionally cultured type. This shows scaffold cultures has a higher susceptibility to APAP-induced cell injury compared with conventional monolayer plate cultured cells.

Fig 5: Cytotoxicity of APAP: dose-dependent effect on Huh-7 cell lines

Fig 6: Sensitivity to APAP-induced cellular injury on Huh-7 cell lines

DNA Quantification:

Both cell lines grown on scaffolds upon APAP treatments lead to a decrease in DNA content (Fig. 7). In comparison to the conventionally cultured plates after APAP treatment for 48h results in lower DNA content suggesting enhanced cell death. Huh-7 cells were treated with 10mM concentrations for both scaffold and conventional cultures. DNA quantification, in turn, confirms the more susceptibility to APAP from scaffold culture system.

Fig 7: DNA quantification Huh-7 cell lines

Quantitative Real-Time Polymerase Reaction (qRT-PCR):

For characterization of differences in gene expression patterns between the scaffold culture and control culture conditions, mRNA levels of different phase I (CYP1A2, 2B6, 2C9, 2D6,3A4) and phase II (UGT1A1, 1A6) xenobiotic-metabolizing enzymes, nuclear receptors (CAR, PXR) and the liver marker albumin (Alb) were determined.

After normalizing raw data to the housekeeping gene (GAPDH) expressions, values were calculated relative to expression levels of Huh-7 cells cultivated under scaffold conditions for 3 days. A time-dependent increase in gene expression was observed for CYP1A2, CYP2E1, CYP3A4, UGT1A1, and UGT1A6 for Huh-7 cells grown in scaffolds. CYP2C9 and albumin expression were also enhanced in Huh-7 cells cultured in presence of scaffolds. The results are represented in Fig 8.

Fig 8. Gene expression profile generated from Day 3 and Day 7 scaffold cultures

As shown in Fig 9, the mRNA expression level of CYP2E1 in PDMS scaffold cultured group was 8-fold and 6- fold greater than that of the conventionally cultured group respectively. Next, we compared the expression level of liver marker Albumin (Alb) expression levels; the results 6-fold greater expression in presence of scaffold than that of the conventional culture system.

Fig 9: Gene expression profile generated from control and scaffold cultures of Huh-7

DISCUSSION:

The liver represents the main drug-metabolizing organ. For in vitro investigations primary human hepatocytes are considered to be the gold standard for liver-specific toxicity and metabolism of xenobiotics ^[25]. Due to their high cost, low and difficulty in availability and inter-donor variability researchers are searching for an alternative in vitro model representing an additional appropriate substitute for human liver. In the last decades, several human hepatoma cell lines (Huh-7, HepG2, HepaRG) were established and commonly used to assess hepatotoxicity of xenobiotics. These cell lines combine the advantages of an unlimited life span, high availability, easy handling and high reproducibility of experimental results due to a stable phenotype expression for many generations^[26]. As an alternative, liver cell lines cultured in two-dimensional (2D) monolayers are become popular to investigate the effects of xenobiotics on human hepatocytes. However, 2D cell cultures have several limitations regarding morphology, biochemical properties, and enzyme activities compared to primary hepatocytes as well as the whole organ itself ^[27-28]. Numerous amounts of data suggest that when immortal cells are grown in three-dimensional (3D) environments (in suspension, on scaffolds in presence of perfusion etc), they express a number of physiological characteristics and resemble more closely the native tissue from which they originated than the same cells grown in classical two-dimensional (2D) culture flasks. The reason for this has been suggested to be related to the fact that 3D cell culture allows the cells to develop a more elaborate extracellular matrix and better intercellular communication^[29-30], and this leads to recovery or maintenance of in vivo function. Three-dimensional (3D) structure has, therefore, will provide in vitro models that sufficiently mimic in vivo conditions and it serves as a better platform for drug toxicity related studies^[31].

In the present study, we have designed, fabricated and tested a scaffold culture system. These PDMS scaffolds are subjected to a gene expression study of drug-metabolizing enzymes. From the results, can observe an increase in gene expression of phase I and II xenobiotic and metabolizing genes and also albumin expression was also enhanced in Huh-7 cells cultured under scaffold conditions. Whereas the culture of Huh-7 cells in controls resulted in decreased expression values of analyzed target genes after 7 days compared to Huh-7 cells grown in scaffold conditions. Therefore, it can be concluded from our study that the scaffold incorporated culture system can be a good platform for drug testing and toxicity studies as any new drug to enter market need to clear liver toxicity test. We also demonstrated that scaffold-cultured Huh-7 cells showed higher susceptibility to APAP-induced cell injury compared with conventional monolayer plate cultured cells, as well as higher expression of CYP2E1 mRNA. The PDMS scaffold system, a 3D-cultured method, may explain mechanisms of cytotoxicity more accurately than conventionally cultured methods and be more useful in toxicological and pharmacological safety assessment. Based on these facts, we believe that the PDMS-scaffold system, which requires neither specialized techniques nor expensive apparatus, may be a valuable tool as a convenient human in vitro model of APAP-induced hepatotoxicity. In summary, we have demonstrated that PDMS-scaffold cultured Huh-7 cell lines show improved gene expression of drug-metabolizing markers and key mechanistic features of APAP-induced hepatotoxicity, such as increased susceptibility to APAP doses and elevated levels of CYP2E1 expression compare to conventional culture method. There many hepatoprotective herbal compounds are examined for cytotoxicity caused due to overdoses of APAP^[32-34]. In our work we had demonstrated an effective cell culture platform to study APAP toxicity studies.

Our future studies will be aiming to measure intracellular GSH and mitochondrial membrane potential, activation of JNK, and cellular injury, after APAP treatment. Including and demonstrating the antidotes of APAP-induced hepatotoxicity, such as NAC, SP600125, and CyA. However, the present study suggests that cellular injury induced by APAP treatment using the PDMS-scaffold is a useful human model to study toxicity mechanisms and to screen drug candidates against APAP-induced hepatotoxicity. And exploring the possibilities of utilizing PDMS scaffolds for long term culture and evaluating the expression of drug-metabolizing genes.

ACKNOWLEDGEMENT:

The authors are thankful to the Indian Council of Medical Research, New Delhi for providing Senior Research Fellowship for the first author. The authors are grateful to the M2D2 laboratory Mechanical Engineering, IISc, Bengaluru for providing the facility and instruments for conducting the research work.

REFERENCES:

1. Potter SM, DeMarse TB. A new approach to neural cell culture for long-term studies. Journal of neuroscience methods. 2001;110(1-2):17-24.

2. Hausen P, Riebesell M. A simple flow-through micro-chamber for handling fragile, small tissue explants and single non-adherent cells. Methods in cell science. 2002; 24(4):165-8.

3. Tan GD, Toh GW, Birgersson E, Robens J, van Noort D, Leo HL. A thin‐walled polydimethylsiloxane bioreactor for high‐density hepatocyte sandwich culture. Biotechnology and bioengineering. 2013; 110(6):1663-73.

4. Saumya S, Anbuselvan A, Poorva S, Priya G. A review on 3D printing techniques and scaffolds for auricular cartilage reconstruction. Research Journal of Pharmacy and Technology. 2018; 11(9):4179-86.

5. Aswin KS, Jothishwar S, Nayagam VC, Priya G. Scaffolds for biomolecule delivery and controlled release - A Review. Research Journal of Pharmacy and Technology. 2018; 11(10):4719-30.

6. Young RJ. Dextropropoxyphene overdosage. Drugs. 1983; 26(1):70-9.

7. Ennis ZN, Dideriksen D, Vaegter HB, Handberg G, Pottegård A. Acetaminophen for chronic pain: a systematic review on efficacy. Basic & clinical pharmacology & toxicology. 2016;118(3):184-9.

8. Zainuddin HZ, Zainuddin LR. Paracetamol induced liver morphological changes after acute dosing. Research Journal of Pharmacy and Technology. 2015; 8(4):382.

9. Manov I, Hirsh M, Iancu TC. Acetaminophen hepatotoxicity and mechanisms of its protection by N-acetylcysteine: a study of Hep3B cells. Experimental and Toxicologic Pathology. 2002; 53(6):489-500.

10. Manov I, Hirsh M, Iancu TC. N‐acetylcysteine does not protect HepG2 cells against acetaminophen‐induced apoptosis. Basic & clinical pharmacology & toxicology. 2004; 94(5):213-25.

11. Latchoumycandane C, Goh CW, Ong MM, Boelsterli UA. Mitochondrial protection by the JNK inhibitor leflunomide rescues mice from acetaminophen‐induced liver injury. Hepatology. 2007; 45(2):412-21.

12. Manokaran S, Jaswanth A, Sengottuvelu S, Nandhakumar J, Duraisamy R, Karthikeyan D, Mallegaswari R. Hepatoprotective activity of Aerva lanata Linn. against paracetamol induced hepatotoxicity in rats. Research journal of pharmacy and technology. 2008; 1(4):398-400.

13. Conover CA, Lee PD. Insulin regulation of insulin-like growth factor-binding protein production in cultured HepG2 cells. The Journal of Clinical Endocrinology and Metabolism. 1990; 70(4):1062-7.

14. Sassa S, Sugita O, Galbraith RA, Kappas A. Drug metabolism by the human hepatoma cell, Hep G2. Biochemical and biophysical research communications. 1987; 143(1):52-7.

15. Nakamura K, Mizutani R, Sanbe A, Enosawa S, Kasahara M, Nakagawa A, Ejiri Y, Murayama N, Miyamoto Y, Torii T, Kusakawa S. Evaluation of drug toxicity with hepatocytes cultured in a micro-space cell culture system. Journal of bioscience and bioengineering. 2011; 111(1):78-84.

16. Nakamura K, Kato N, Aizawa K, Mizutani R, Yamauchi J, Tanoue A. Expression of albumin and cytochrome P450 enzymes in HepG2 cells cultured with a nanotechnology-based culture plate with microfabricated scaffold. The Journal of toxicological sciences. 2011; 36(5):625-33.

17. Aritomi K, Ishitsuka Y, Tomishima Y, Shimizu D, Abe N, Shuto T, Irikura M, Kai H, Irie T. Evaluation of three-dimensional cultured HepG2 cells in a nano culture plate system: an in vitro human model of acetaminophen hepatotoxicity. Journal of pharmacological sciences. 2014;13135FP.

18. Domansky K, Inman W, Serdy J, Dash A, Lim MH, Griffith LG. Perfused multiwell plate for 3D liver tissue engineering. Lab on a chip. 2010;10(1):51-8.

19. LeCluyse EL. Human hepatocyte culture systems for the in vitro evaluation of cytochrome P450 expression and regulation. European journal of pharmaceutical sciences. 2001; 13(4):343-68.

20. Kumar MS, Aanandhi MV. An Insight into the Therapeutic Potential of Pyridopyrimidines as Anticancer Agents. Research Journal of Pharmacy and Technology. 2018; 11(3):1259-69.

21. Nandhakumar L, Dharmamoorthy G, Chandrasekaran S. Hydrogels: A multifaceted contemporary approaches and advancements. Research Journal of Pharmacy and Technology. 2011; 4(11):1658-62.

22. Narayanan AV, Charyulu RN. Pharmacoelectronics and electropharmaceutics: the arts and science of electronic drug delivery. Research Journal of Pharmacy and Technology. 2017; 10(10):3544-8.

23. Senthilraja P, Kathiresan K. In vitro cytotoxicity MTT assay in Vero, HepG2 and MCF-7 cell lines study of Marine Yeast. J Appl Pharm Sci. 2015; 5(3):080-4.

24. Kumar S, Raj S, Sarkar K, Chatterjee K. Engineering a multi-biofunctional composite using poly (ethylenimine) decorated graphene oxide for bone tissue regeneration. Nanoscale. 2016; 8(12):6820-36.

25. Godoy P, Hewitt NJ, Albrecht U, Andersen ME, Ansari N, Bhattacharya S, Bode JG, Bolleyn J, Borner C, Boettger J, Braeuning A. Recent advances in 2D and 3D in vitro systems using primary hepatocytes, alternative hepatocyte sources and non-parenchymal liver cells and their use in investigating mechanisms of hepatotoxicity, cell signaling and ADME. Archives of toxicology. 2013; 87(8):1315-530.

26. Weaver VM, Petersen OW, Wang F, Larabell CA, Briand P, Damsky C, Bissell MJ. Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. The Journal of cell biology. 1997; 137(1):231-45.

27. Daus AW, Goldhammer M, Layer PG, Thielemann C. Electromagnetic exposure of scaffold‐free three‐dimensional cell culture systems. Bioelectromagnetics. 2011; 32(5):351-9.

28. Lin RZ, Chou LF, Chien CC, Chang HY. Dynamic analysis of hepatoma spheroid formation: roles of E-cadherin and β1-integrin. Cell and tissue research. 2006; 324(3):411-22.

29. Loessner D, Stok KS, Lutolf MP, Hutmacher DW, Clements JA, Rizzi SC. Bioengineered 3D platform to explore cell–ECM interactions and drug resistance of epithelial ovarian cancer cells. Biomaterials. 2010; 31(32):8494-506.

30. Noh JR, Kim YH, Hwang JH, Gang GT, Kim KS, Lee IK, Yun BS, Lee CH. Davallialactone protects against acetaminophen overdose-induced liver injuries in mice. Food and chemical toxicology. 2013; 58:14-21.

31. Fey SJ, Wrzesinski K. Determination of drug toxicity using 3D spheroids constructed from an immortal human hepatocyte cell line. Toxicological sciences. 2012; 127(2):403-11.

32. Samal PK, Dangi JS, Meena KP, Beck NR, Maheshwari G, Patel A. Hepatoprotective activity of Butea monosperma bark on liver damage caused by paracetamol in rats. Research Journal of Pharmacy and Technology. 2011;4(5):771-4.

33. Bhavani R, Geetha G, Santhoshkumar J, Rajeshkumar S. Evaluation of Antibacterial action and Hepatoprotective efficiency of Solanum nigrum leaves extract on acetaminophen induced hepatotoxicity Research Journal of Pharmacy and Technology. 2015; 8(7):893900.

34. Manokaran S, Saravanan VS, Bhargavi Y. Hepatoprotective activity of Prunus persica peaches against paracetamol induced hepatotoxicity. Research Journal of Pharmacognosy and Phytochemistry. 2011; 3(2): 75-76

Received on 11.09.2019 Modified on 26.11.2019

Research J. Pharm. and Tech 2020; 13(5):2399-2406.

DOI: 10.5958/0974-360X.2020.00431.X

Class	Name	Primer forward	Primer reverse
CYP	CYP1A2	CTCCTCCTTCTTGCCCTTCA	GTAGAAGCCATTCAGCGTTGTG
	CYP2B6	TTCCTACTGCTTCCGTCTATCAAA	GTGCAGAATCCCACAGCTCA
	CYP2C9	AAGGAGATCCGGCGTTTCTC	CGGTCCTCAATGCTCCTCTTC
	CYP2D6	GACCAGAGATGGGTGACCAG	CGATGTCACGGGATGTCATA
	CYP2E1	CATGAGATTCAGCGGTTCATC	GGTGTCTCGGGTTGCTTCA
	CYP3A4	TCAGCCTGGTGCTCCTCTATCTAT	AAGCCCTTATGGTAGGACAAAATATTT
UGT	UGT1A1	CCAACCCATTCTCCTACGTG	CTGTGAAAAGGCAATGAGCA
UGT	UGT1A6	CCTGGAGCATACATTCAGCAGAA	AAGGAAGTTGGCCACTCGTTG
Nuclear receptors	CAR	ATGCTGGCATGAGGAAAGAC	GTTGCACAGGTGTTTGCTGT
Nuclear receptors	PXR	GGCATGAAGAAGGAGATGAT	TGGGAGAAGGTAGTGTCAAA
Liver marker	Albumin	TGCTTGAATGTGCTGATGACAGG	AAGGCAAGTCAGCAGGCATCTCATC
Housekeeping	GAPDH	ATTTGGCTACAGCAACAGGG	CAACTGTGAGGAGGGGAGA