Human Coronavirus Species and their correlation as co-infection detected by Fast Real-Time RT-PCR

 

Hala A. Salah¹, Iman M. Aufi², Hula Y. Fadhil¹*, Faisal G. Alhamdani²

¹Biology Department, College of Science, University of Baghdad, Baghdad-Al-Jadiria, Iraq.

²Department of Virology, The National Central Public Health Laboratory (NPL),

Ministry of Health, Baghdad, Iraq.

 

ABSTRACT:

This study aimed to award a local database for detection of human coronavirus (HCoV) species in patients with respiratory tract infections like influenza type A and a tuberculosis using Taqman reverse transcriptase real-time PCR (rRT-PCR) technique. A total of 389 respiratory samples was collected from individuals suffering from upper and/or lower respiratory tract diseases for testing of HCoV species (229E, OC43, NL63, HKU1 and MERS). RNA extracted and amplification with specific primers and probes. Result showed 35 (9%) positive sample and the probe assay associated with cycle number (Ct) was 33.98±0.97. It is interesting to note, the results pointed out 12/35 (34.29%) co–infected with the most frequently Flu A and the relative risk value represented 21.5 (95% Cl 4.9-93.9) of cohort influenza type A positive case. Moreover, the co-infection with pulmonary tuberculosis (TB) was 5/35 (14.29%) of HCoVs cases and the relative risk value 1.53 (95% Cl 0.68-3.45) of cohort TB positive cases. The percentage of a positive cases have a single HCoV species higher than multiple HCoV species with 31/35 (88.57%) and 4/35 (11.43%), respectively, and each viral species reported higher percentage as a single species than multiple. Also, the frequency of HCoV-229E and NL63 species consisted highest percentage 75% of four HCoV species with significant presence among Iraqi studying populations. Furthermore, the percentage of influenza virus A cases with HCoV infections were 7/12=58.33% with species 229E, while 60% of HCoV with TB infection appeared in NL63. In conclusion, the rRT-PCR based on Taqman observed the rapid and efficient detection of CoVs species with few copies number. This allows to be used for the diagnosis of CoVs along with other respiratory viruses in a multiplex assay to reduce processing time. Subsequent applied multiplex RT-PCR along with influenza and TB infections.

 

 

INTRODUCTION:

As proposed by the International Committee for Taxonomy of Viruses, coronaviruses (CoVs) are further categorized into four main genera, Alpha-, Beta-, Gamma- and Delta coronaviruses based on sequence comparisons of entire viral genomes. The hypothesized that most of the human coronaviruses may have originated from bats^1,2.

 

These viruses involve four yearly circulating viruses have been detected worldwide nearly 50 years ago: HCoV-229E (an Alphacoronavirus), HCoV-NL63 (An Alphacoronavirus), HCoV-OC43 (a Betacoronavirus), and HCoV-HKU1 (a Betacoronavirus)³ as well as two emerging coronaviruses which  have caused unexpected human disease outbreaks, Severe Acute Respiratory Syndrome (SARS-Cov) (a Betacoronavirus) and Middle East Respiratory Syndrome coronavirus (MERS-Cov) (a Betacoronavirus) has recently identified which causing severe disease⁴.

 

Recombination happenings in the spike, nucleocapsid and the RNA dependent RNA polymerase within the 1a gene of HCoV-OC43 and HCoV-HKU1 leading to the appearance of unique recombinant genotypes have been reported⁵. They infect the human airway from the luminal side and progeny viruses are released from the same side facilitating spread through coughing and sneezing⁶.

 

Coronaviruses are frequently co-detected with other respiratory viruses, particularly with the influenza type A and human respiratory syncytial virus (HRSV) in upper respiratory infections⁷. While the bacterial infections in lower respiratory tract like pulmonary tuberculosis, which decreasing in the immune system status, so do the patient more susceptible for infecting with more than circulating HCoVs and may be due to interaction between various HCoV species themselves. Moreover, there is no previous study documented for HCoV appearance with TB infections. Thus, this study aimed to award a local database for detection of human coronavirus (HCoV) species in patients with respiratory tract infections like influenza type A and a tuberculosis using Taqman reverse transcriptase real-time PCR (rRT-PCR) technique.

 

MATERIAL AND METHODS:

Clinical samples:

A total of 389 samples was collected from individuals between November 2018 to April 2019 from various public hospitals at different Iraqi provinces. The specimens included upper respiratory 237 (nasopharyngeal and throat swabs), and lower respiratory 152 (tracheal aspirates, bronchoalveolar lavage (BAL and sputum) for testing of human coronaviruses species (229E, OC43, NL63, HKU1 and MERS-COV).

 

RNA extraction:

All upper respiratory tract samples (389 nasopharyngeal and throat swabs) that gave negative (313) and positive (76) results of Influenza test and also all lower respiratory tract samples (152 Sputum, bronchial aspiration and fluids from lung washing) were selected for RNA extraction to detect five human coronaviruses by using a specific kits: QIAamp Viral RNA Mini Kit (GmbH, Hilden, Germany) as described according to manufacturer’s instructions. With some modification in the sputum samples performed on sample collection, these included mixing a small volume of sputum (about 150µl) to 500µl of Qiagen lysis buffer. Then incubated for 30 minutes at 80Cº, and stored the specimen at deep freeze -80Cº until the use.

 

Fast Real-Time Reverse transcription-Polymerase Chain Reaction (rRT-PCR)

All the clinical samples were tested by rRT-PCR using the specific primers with probes in the Taqman assay for detecting four HCoV species (229E, NL63, OC43 and HKU1). Moreover, the Taqman assay performed for investigating MERS-CoVs in 152 LRT samples with specific primers and probes as a separated test.

 

Detection of MERS-CoVs in Taqman assay:

Two pairs of specific primers and probes were used to detect the human coronavirus (MERS-COV) from LRTI samples and amplify two genes: upE and N2 (highly conserved) of this virus used SuperScript III platinum One step RT-PCR (Ivitrogen, USA). Forward primer sequence (upE) gene: (5ʹ-GCAACGCGCGATTCAGTT-3ʹ), reverse primer sequence for (upE) gene: 5ʹ-GCCTCTACACGGGACCCATA-3ʹ), and probe (5ʹ-CTCTTCACATAATCGCCCCGAGCTCG-3ʹ). Forward primer sequence for (N2) gene: (5ʹ-GGCACTGAGGACCCACGTT-3ʹ), reverse primer sequence for (N2) gene: (5ʹ-TTGCGACATACCCATAAAAGCA-3ʹ), and probe (5ʹ-CCCCAAATTGCTGAGCTTGCTCCTACA-3ʹ). The Probes were labeled at the 5′ reporter dye FAM and the 3′ quencher dye (BHQ1)⁸.

 

For each gene, the master mix was prepared in using one step rRT-PCR assay. It was added to 5μl RNA templates, 0.5 pmol cons. of each primer and 0.3 pmol conc. of the probe in 10μl reaction mixture. The master mix reagents prepared according to the instruction kit. Amplification and detection were done RT step activation at 50C for 5min, Initial denaturation at 95 ̊c for 2min, followed 45 cycles: 95 C for 3sec and 55 C for 1 min finally hold stage at 72 C for 1min⁹.

 

Table 1. Sequences of primers and probes using in Fast rRT-PCR

Virus	Primer/Probe	Sequence  5´-3´
HCoV 229E	Forward	CAGTCAAATGGGCTGATGCA
	Reverse	AAAGGGCTATAAAGAGAATAAGGTATTCT
	Probe	FAM CCCTGACGACCACGTTGTGGTTCA BHQ-1
HCoV OC43	Forward	CGATGAGGCTATTCCGACTAGGT
	Reverse	CCTTCCTGAGCCTTCAATATAGTAACC
	Probe	FAM TCCGCCTGGCACGGTACTCCCT BHQ-1
HCoV NL63	Forward	GACCAAAGCACTGAATAACATTTTCC
	Reverse	ACCTAATAAGCCTCTTTCTCAACCC
	Probe	FAM AACACGCTTCCAACGAGGTTTCTTCAACTGAG BHQ-1
HCoV HKU1	Forward	CCTTGCGAATGAATGTGCT
	Reverse	TTGCATCACCACTGCTAGTACCAC
	Probe	FAM TGTGTGGCGGTTGCTATTATGTTAAGCCTG BHQ-1

 

Detection of human coronaviruses (229E, HKU1, OC43 and NL63-CoVs) with Taqman systems: 

Four pairs of specific primers and probes were used to rRT-PCR detection and amplify the RNA-dependent RNA polymerase (RdRp) gene of HCoVs (229E, HKU1, OC43 and NL63) which contains ORF1a and ORF1b as mentioned in table 1 for all upper and lower respiratory samples¹⁰.

 

In Taqman detection, the master mix was prepared according to the manufacture of SuperScript III platinum one step RT-PCR kit (Ivitrogen, USA). A master mix tube contains all the components included 6.25µl reaction buffer (5x), 0.5µl Super Script TM III RT/Platinum TM Taq mix, 0.75µl of each primer and probe and subsequent distributed to specific wells that containing 5µl RNA template in 10µl final reaction. The amplification and detection were performed RT step activation at 50 ̊c for 30min, Initial denaturation at 95 ̊c for 15min, followed 45 cycles: 95 C for 3sec and 55 ̊c for 4 sec, and hold stage at 72 C for 30sec. 

 

Statistical analysis:

The statistical analysis system was analyzed by IBM SPSS Statistics version 25. All values, proportions and their frequencies were checked by applying the Pearson chi – square (X2) and cross tab test to investigate significant comparison between viral infection percentages in different studying markers of population study. Also, the odds ratio for the appearance of HCoV infections along with influenza type A and tuberculosis (TB) infections were calculated for cohort human coronavirus patients. A value of P<0.05 was considered statistically significant.

 

RESULTS AND DISCUSSION:

Multiples TaqMan probe assay of Four species HCoVs detection:

Result showed 35(9%) true positive sample and the multiplex probe assay associated with cycle number (Ct) was 33.98±0.97 (mean±SE) (Fig. 1). In order to determine and verify positive HCoV samples in this assay, this represented the refractive cycle amount at which a favorable amplification was measured, based on the cycle limit, and was set at 10 times the standard deviation of the mean baseline emission calculated for PCR cycles. The negative remaining samples of the total upper and lower respiratory samples may be patients have the same symptoms, but strongly associated with other viruses, bacteria and fungi^11-15.

 

It is interesting to note, among the 35 HCoV-positive cases, the results pointed out 12/35 (34.29%) co–infected with the most frequently identified respiratory pathogen was Flu A, that co-infection may influence the clinical presentation of HCoV-positive patients and may increase of the severity of respiratory tract illnesses. This agreed with a study was conducted in China during 2010–2015 found that of the 294 HCoV positive patients, 101 cases were co-detected by other common respiratory viruses, and influenza virus was the most common co-infecting virus with percentage  (30/101, 29.70%)¹². Furthermore, the relative risk value (RR) represented 21.5 (95% Cl 4.9-93.9) of cohort influenza type A positive case, while the odds ratio (OR) value showed 25.31 (95% Cl 5.53-115.91) for HCoV patients. Likewise, a rising occurrence of HCoV infection along with an increasing influenza infection incidence of individuals healthy in the influenza season, thus these increases were highly significant between studying groups (X²=34.87, P<0.01; Fisher exact test P value <0.01).

 

Fig. 1 TaqMan Real-Time PCR multicomponent plot of a single positive HCoV sample with high viral load (22), based on the RdRp gene primers and probe (VIC) green dye of the sputum sample for a patient with TB. Green color is referring to NL63-HCoV.

 

These findings suggest that HCoV infections overlap seasonally with the influenza infections. Therefore, should be continuous surveillance for HCoVs at the national level is needed to distinguish HCoVs infections from influenza infections in a clinical setting such as the occurrence of outbreak of Human Coronavirus OC43 during the 2014–2015 influenza season in Japan¹³.

 

The most important observation in this study, we found some patients infected with HCoV, who were co-infected with pulmonary TB with rate 5/35 (14.29%) of HCoVs cases. This may be a causative agent for increasing HCoVs detection in LRT than in URT. Co- infections are commonly related and found mostly among patients with high viral load than those with low viral load indicating that patients with high HCoV viral load were more likely to be co-infected with other infectious diseases such as TB, hence HCoV co-infection with TB appearance may increase with the severity of pulmonary disease. The investigators suggest that CoV temporary suppresses cellular immunity, which may predispose patients to reactivation or new infection with TB¹⁴. HCoV and TB may cause immune suppression and augment the infection of each other, as was described with SARS and TB¹⁵ and MERS and TB¹⁶.

 

Approximately, the relative risk value (RR) 1.53 (95% Cl 0.68-3.45) of cohort TB positive cases similar to odds ratio (OR) value 1.75 (95% Cl 0.57-5.41) for HCoV patients. Thus, a rising occurrence of HCoV infection along with increasing TB incidence than non-TB individuals, but these increase non-significant among studying groups (X²=0.96, P>0.05; Fisher exact test P value >0.05).

 

There are no previous studies explaining 4HCoV co infected with TB, but only this single study was conducted in Spain between 2013-2016 showing, important observation was from 8/21 (38%) of cases HCoVs were detected, have 3 cases with proven HCoVs LRTD also had bacterial or fungal co-infection detected in the BAL sample, 2 cases with Stenotrophomonas maltophilia and Mycobacterium tuberculosis, respectively, and 1 with Pneumocystis jirovecci detected by PCR. Frequency of co-infections may be makes it difficult to interpret the clinical significance of CoVs on their own because the clinical effects cannot be attributed to their presence alone¹⁷.

 

The most important observation in this study, the percentage of a positive cases have a single HCoV species higher than multiple HCoV species with 31/35 (88.57%) and 4/35 (11.43%), respectively, and each viral species reported higher percentage as a single species than multiple. Figure 1 demonstrates the frequency of each HCoV species, both single and multiple among positive case detection.

 

Moreover, the appearance of multiple HCoV species was along with LRT infections like a cute Pneumonia, Bronchitis and TB cases. There are multiple HCoV species like 229E-HCoV and NL63-HCoV in the same LRT sample of patient infected with severe lower respiratory tract infection (pulmonary TB).  Because of bacterial infection which decreasing in the immune system status, so does the patient more susceptible for infecting with more than circulating HCoVs and may be due to interaction between various HCoV species themselves. The presence  of two viruses in this sample with high viral load, the percentage  infected with 229E-HCoV  more than NL63-HCoV. Throughout 2010–2015 in Guangzhou, South China, four species of HCoVs were detected in patients with acute respiratory infection symptoms. Of the 294 total positive cases of HCoV, there was 1 case (22 years old female) detected as co- infected by both OC43 and HKU1, but there was no indicate that co-infection observed in more serious symptoms¹².

 

Fig. 2 Frequency of HCoV species single and multiple among positive case detection by TaqMan assay.

 

Although the frequency of HCoV-229E and NL63 species consisted highest percentage 75% of four HCoV species with significant presence among Iraqi studying populations (X²꞊ 10, P<0.01), there are different HCoV species showed non-significant between single and multiple species in positive cases (X²꞊ 0.49, P>0.05).

 

Interestingly, the study has been reported in France during 2008-2011, appearing a higher incidence of 229E-HCoV subtype 120/355 (33.8%) was predominate during several months in 2010 and to a greater extent in 2011. Taken together, these data suggest a persistent epidemic of HCoV-229E at that time in the population¹⁸. However, in contrast to the results of two previous studies conducted on the upper respiratory tract samples by RT-PCR in Hong Kong, China, the first was during six-year period (2008-2014) which showing the most frequently detected HCoV species was HCoV-OC43 48/8275 (0.58%), followed by HCoV-229E 12/8275 (0.15%), HCoV-HKU1 11/8275(0.13%) and HCoV-NL63 6/8275 (0.07%) of the least importance¹⁹. This variation in the incidence of HCoVs may be due to different sampling strategies having led to different detection rates²⁰, various detection methods may show different sensitivities towards virus detection. Whereas, Nested PCR and real-time PCR have shown to be more sensitive in detecting HCoV-OC43 and 229E when compared to conventional detection assays²¹. Also, HCoVs may exhibit different geographical variations in incidence²².

 

The second study was conducted in Guangzhou between 2010- 2015 by using the rRT-PCR technique, showed 294/13048 (2.25%) was HCoV positive patients with respiratory infection symptom. Totally 4 HCoV species, including HCoV-229E, OC43, NL63 and HKU1 were detected. Of the locally epidemic HCoVs, OC43 was the most commonly detected, followed by 229E and NL63, and HKU1 detection rate was the lowest and no SARS and MERS-CoV was detected, confirming that the outbreak of highly pathogenic MERS-CoV in the year 2015 in South Korea did not spread to Guangzhou¹².

 

Regarding the CoV types, and in contrast with Milano et al.²³ and others²⁴, there another study observed that the most common circulating CoV was type OC43 (48%) followed by NL63 (24%), KHU1 (19%), and the 229E subtype (9%)¹⁷. Whereas another study conducted in Kenya between 2009-2012, showing 35/415 positive for human coronaviruses with Ct values ranging from 21 to 39. The study observed percentage 14/35 (37%) of alphacoronaviruses and 21/35 (63%)of betacoronaviruses.  Amongst the alphacoronaviruses, 4 were HCoV-229E and 10 were HCoV-NL63. Betacoronaviruses consisted of 12 HCoV-OC43 and 9 HCoV-HKU1 species. Thus the prevalence of the various HCoVs was 1% for 229E, 2 % for NL63, 3 % OC43 and 2% of the HKU1. Also, they observed five co-infections with a HCoV. These included two triple co-infection involving HKU1 and NL63 with influenza A (H3N2)²⁵.

 

Furthermore, the percentage of influenza virus A cases with HCoV infections was 7/12=58.33%, especially, appeared with species 229E in this study, while the other cases (41.67%) accompanied with the remaining species (NL63, OC43 and HKU1). Nevertheless, there are no statistical differences (X²=2.56, P>0.05) between their observation among infected cases. 229E–HcoV was recorded in this study the highest percentage of infection in URT of total HcoV species infection.

 

 

Van Elden et al.,²⁶ reported that 229E-HcoV is responsible for 10% of upper respiratory tract infections in developed countries. We think these percentages were unstable, may be different from one study to another according to many factors (age group, number of collected samples, study population and location), this confirms when we are comparing with other previous study in China, which conducted on hospitalized children with acute respiratory infection, the result was of the 231 HcoV positive samples, were co-infected with 50/231 (21.6%) of Flu A. Whereas OC43 was recorded the highest percentage 38/50 (23.6%) than other remaining species were recorded: 229E 7(18.4%), NL63 and HKU1 4 (21.1%)¹².

 

On the other hand, the percentage of TB cases with HCoV infections was 60%, especially, appeared with species NL63 in this study, while the other cases (40%) accompanied with the remaining species (229E, OC43 and HKU1). Thus, there are slightly statistical differences (X²=4, P=0.04) between their observation among infected cases.

 

Figure 3 shows a comparison of the frequency percentages of HCoVs species between upper and lower respiratory tract infections. Statistical analysis showed highly significant for 229E-HCoV in URTI (X²=89.78, P<0.01) with percentage (77.8%) from other viral infected species,  These findings are similar to previous reports that identified HCoV-229E as been commonly associated with upper respiratory tract infections²⁷.

 

Fig. 3 Frequency percentages of HCoVs Species of total among each upper and lower respiratory infections. The asterisk indicates the high significant observation from other viral infected species.

 

Meanwhile the highly significant for NL63-HCoV in LRTI (X²=31.04, P<0.01) with percentage (45.2%),  this similar to other  studies^28,29. Whereas, both OC43-HCoV and HKU1-HCoV were recorded low percentages in URTI and LRTI. The HCoV detection rates differ from one study to other this variation may be belonging to the incidence of the four HCoVs varies according to the location and study population, with ranges from 0% to 8%.³⁰. The burden of HCoV-related URI varied significantly from year to year. In some seasons, a single virus strain circulated, while in others there were two or even three viral strains³¹.

 

TaqMan probe assay For MERS HCoVs detection:

MERS-CoV diagnosis remains a significant problem in most diagnostic laboratories around the world. To date the Real-time Polymerase Chain reaction (RT-PCR) is the mainstay for diagnosis of MERS-CoV. RT-PCR has limitations, including long processing times and absence of prevalent viral load (VL) measurements and correlations. Screening for MERS-CoV using upstream envelope gene (upE) RT-PCR followed by confirmation of the existence of one of the following genes; open reading frame 1A, 1B genes or nucleocapsid (N) gene is suggested³². In the current study of 500 respiratory samples, we tested 40 lower respiratory tract samples by TaqMan based probe Real-time PCR of hospitalized  pateints sufferening from symptoms similar to patients infected with MERS-CoV. All of the samples in our study gave negative results.

 

Although MERS-CoV infections have been identified in many countries all over the world whereas high level occurrences have been documented in the Middle East³³ and Korea³⁴. MERS-CoV is mainly spreading across the geographical region of the Middle East, especially in the Arabian Peninsula, while some imported sporadic cases were reported from the Europe, North America, Africa, and lately Asia³⁵ but in the current study did not record  any positive result of  MERS-CoV in our samples maight be due to by difficulty in transmission as lower respiratory tract shedding of the virus  and the tramsmission of MERS-CoV should be close contact with MERS-CoV infected patients or with camels which considred reservoirs. Also may be samples collected from some of Iraqi provinces which did not detect any infection with MERS-CoV. Also, most of our patients might  be recovered from virus infection before the detection and the presence of some degree of immunity.  A total of 12 previous studies reported the incubation period of MERS, showed 4-7 day incubation period^36-38.

 

Additionally, we can refer to a recent study conducted on humans and camel in Iraq during 2015-2016, shown despite of  high infection rate of camels, did not record any positive results of  camels’ owners who direct contact with camels and throughout consumption of animal products. On the other hand, there were positive results with lower rates  recorded among pilgrims whom they may become infected during the period of pilgrimage in Mecca / Saudi Arabia with percentage 2/30 (6.66%) female and 3/70 (4.28%) female³⁹.

In conclusion, the rRT-PCR based on Taqman observed the rapid and efficient detection of CoVs species with few copies number. This allows to be used for the diagnosis of CoVs along with other respiratory viruses in a multiplex assay to reduce processing time. Subsequent applied multiplex RT-PCR along with influenza and TB infections.

 

REFERENCES:

1.      Huynh J, Li S, Yount B, Smith A, Sturges L, Olsen JC, Nagel J, Johnson JB, Agnihothram S, Gates JE, Frieman M.B, Baric RS and  Donaldson EF. Evidence supporting a zoonotic origin of human coronavirus strain NL63. J Virol.86; 2012:12816–25.

2.      Drexler JF, Corman VM and Drosten C.  Ecology, evolution and classification of bat coronaviruses in the aftermath of SARS. Antiviral Res.10; 12014:45–56.

3.      Gaunt ER, Hardie A, Claas EC, Simmonds P and Templeton KE. Epidemiology and clinical presentations of the four human coronaviruses 229E, HKU1, NL63, and OC43 detected over 3 years using a novel multiplex real-time PCR method. J Clin Microbiol.48; 2010:2940–2947.

4.      Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD and  Fouchier RA. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J of Med. 367; 2012:1814-1820.

5.      Lau SK, Lee P, Tsang AK, Yip CC, Tse H, Lee RA, So LY, Lau YL, Chan KH, Woo PC and  Yuen KY. Molecular epidemiology of human coronavirus OC43 reveals evolution of different genotypes over time and recent emergence of a novel genotype due to natural recombination. J Virol. 85(21); 2011:11325–37.

6.      Razuri H, Malecki M, Tinoco Y, Ortiz E, Guezala MC, Romero C, Estela A, Breña P, Morales ML, Reaves EJ, Gomez J, Uyeki TM, Widdowson MA, Azziz-Baumgartner E, Bausch DG, Schildgen V, Schildgen O and Montgomery JM.  Human Coronavirus-Associated Influenza-Like Illness in the Community Setting in Peru. Am J Trop Med Hyg.93; 2015:1038–40.

7.      Kuypers J, Wright N and Morrow R. Evaluation of quantitative and tybe- specific real-time RT-PCR assays for detection of respiratory syncytial virus in respiratory specimens fromchildren. J Clin Virol. 31; 2004: 123-129.

8.      Lu X, Whitaker B, Sakthivel SK, Kamili S, Rose LE,  Lowe L, Mohareb E,  Elassal EM, Al-sanouriT,  Haddadin A  and Erdman DD. Real-Time Reverse Transcription-PCR Assay Panel for Middle East Respiratory Syndrome Coronavirus. J Clin Microbiol.52(1); 2014: 67–75.

9.      Huh HJ, Kim JY, Kwon HJ, Yun SA, Lee MK, Ki CS, Lee NY and Kim JW. Performance Evaluation of the PowerChek MERS (upE & ORF1a) Real-Time PCR Kit for the Detection of Middle East Respiratory Syndrome Coronavirus RNA.Ann Lab Med.37(6); 2017:494-498.

10.   Centers for Disease Control and Prevention. Real-Time RT-PCR Assay for Non-Influenza Respiratory Viruses. 2012.

11.   Atyah NS, Fadhil HY,  Al-Hamadani FG, Auffi IM and Al-azzawi MA. Molecular detection of subfamily pneumovirinae among children with flu-like illness by using rt-pcr. Current Research in Microbiology and Biotechnology. 5(5); 2017: 1239-1244.

12.   Atyah NS, Fadhil HY,  Auffi IM  and  Al-Hamadani FG. First identification of Human Bocavirus (HBoV) in Iraqi children with respiratory complications. Journal of Pharmacy and Biological Sciences. 12(6); 2017:15-20.

13.   Khalaf RJ, Fadhil HY, Aufi IM and Namdar SA. Molecular diagnosis of human adenovirus in children with upper respiratory tract infections. Journal of Pharmacy and Biological Sciences. 12(3); 2017:09-13.

14.   Fadhil HY. Real-Time PCR Detection of Respiratory Syncytial virus (RSV) among adults with Pneumonia. Iraqi Journal of Science. 56(2C); 2015:1617-1621.

15.   Fadhil HY. Detection for respiratory syncytial virus rna among children with flu-like illness using molecular assay. International Journal of Current Research. 6 (11); 2014: 9455-9459.

16.   Zhang S, Tuo J, Huang X,  Zhu X, Zhang D,  Zhou K, Yuan L, Luo H, Zheng B, Yuen K,  Li M  and Cao K. Epidemiology characteristics of human coronaviruses in patients with espiratory infection symptoms and phylogenetic analysis of HCoV-OC43 during 2010-2015 in Guangzhou. PLoS One. 13(1); 2018: e0191789.

17.   Matoba Y, Aoki Y, Tanaka S, Yahagi K, Shimotai Y,  Matsuzaki Y, Itagaki T and Mizuta K. An Outbreak of Human Coronavirus OC43 during the 2014-2015 Influenza Season in Yamagata, Japan. Jpn J Infect Dis. 68(5); 2015:442-5.

18.   Chopra KK. SARS-TB co-infection in South East Asia. Indian J Tuberc.52; 2005:52.

19.   Liu W, Fontanet A, Zhang PH, Zhan L, Xin ZT, Tang F, Baril L, Cao WC. Pulmonary tuberculosis and SARS, China. Emerg Infect Dis. 12(4); 2006:707-9.

20.   Alfaraj SH,  Al-Tawfiq JA,  Altuwaijri TA and Memish ZA.  Middle East Respiratory Syndrome Coronavirus and Pulmonary Tuberculosis Coinfection: Implications for Infection Control. Ntervirology. 60; 2017:53–55.

21.   Piñana JL,  Madrid S, Pérez A, Hernández-Boluda JC, Giménez E, Terol MJ, Calabuig M,  Navarro D and Solano C. Epidemiologic and Clinical Characteristics of Coronavirus and Bocavirus Respiratory Infections after Allogeneic Stem Cell Transplantation: A Prospective Single-Center Study. Biol Blood Marrow Transplant. 24; 2018:563–570.

22.   Lepiller Q, Barth H, Lefebvre F, Herbrecht R, Lutz P, Kessler R, Fafi-Kremer S and Stoll-Keller F. High Incidence but Low Burden of Coronaviruses and Preferential Associations between Respiratory Viruses. Journal of Clinical Microbiology. 51(9); 2013:3039-46.

23.   Yip CC, Lam CS, Luk HK, Wong EY, Lee RA, So LY, Chan KH, Cheng VC, Yuen KY, Woo PC and Lau SK. A six-year descriptive epidemiological study of human coronavirus infections in hospitalized patients in Hong Kong. Virol Sin.31(1); 2016:41-8.

24.   Mackay IM, Arden KE, Speicher D, O'Neil NT, McErlean PK, Greer RM, Nissen MD and  Sloots TP. Co-circulation of four human coronaviruses (HCoVs) in Queensland children with acute respiratory tract illnesses in 2004. Viruses. 4; 2012:637–653.

25.   Vijgen L, Keyaerts E, Moës E, Maes P, Duson G and  Van Ranst M. Development of one-step, real-time, quantitative reverse transcriptase PCR assays for absolute quantitation of human coronaviruses OC43 and 229E. J Clin Microbiol. 43; 2005:5452–5456.

26.   Lau SK, Woo PC, Yip CC, Tse H, Tsoi HW, Cheng VC, Lee P, Tang BS, Cheung CH, Lee RA, So LY, Lau YL, Chan KH and Yuen KY. Coronavirus HKU1 and other coronavirus infections in Hong Kong. J Clin Microbiol. 44; 2006:2063–2071.

27.   Milano F, Campbell AP, Guthrie KA, Kuypers J, Englund JA, Corey L and  Boeckh M. Human rhinovirus and coronavirus detection among allogeneic hematopoietic stem cell transplantation recipients. Blood.115(10); 2010:2088-94.

28.   Hakki M, Rattray RM and Press RD. The clinical impact of coronavirus infection in patients with hematologic malignancies and hematopoietic stem cell transplant recipients. J Clin Virol. 68; 2015: 1-5. 28.

29.   Sipulwa LA, Ongus JR, Coldren RL and Bulimo WD. Molecular characterization of human coronaviruses and their circulation dynamics in Kenya, 2009-2012. Virol J. 1(13); 2016:18.

30.   Van Elden LJ, van Loon AM, van Alphen F, Hendriksen KA, Hoepelman AI, van Kraaij MG, Oosterheert JJ, Schipper P, Schuurman R and  Nijhuis M. Frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction. J Infect Dis.189(4); 2004:652-7.

31.   Owusu M, Annan A, Corman VM, Larbi R, Anti P, Drexler JF, Agbenyega O, Adu-Sarkodie Y and Drosten C. Human coronaviruses associated with upper respiratory tract infections in three rural areas of Ghana. PLoS One.9(7); 2014:e99782.

32.   Greenberg SB. Update on rhinovirus and coronavirus infections. Semin Resoir Crit Care Med. 32; 2011: 433–446.

33.   Kim KY, Han SY, Kim HS, Cheong HM, Kim SS and Kim DS. Human Coronavirus in the 2014 Winter Season as a Cause of Lower Respiratory Tract Infection. Yonsei Med J.58(1); 2017:174-179.

34.   Cabeça TK, Passos AM, Granato C and Bellei N. Human coronavirus occurrence in different populations of Sao Paulo: a comprehensive nine-year study using a pancoronavirus RT-PCR assay. Braz J Microbiol.44; 2013:335–339.

35.   Talbot HK, Shepherd BE, Crowe JE, Griffin MR, Edwards KM, Podsiad AB, Tollefson SJ, Wright PF and Williams JV. The pediatric burden of human coronaviruses evaluated for twenty years. Pediatr Infect Dis J.28(8); 2009:682-7.

36.   Al Johani S. and Hajeer AH. MERS-CoV diagnosis: An update. Journal of Infection and Public Health. 9(3); 2016: 216-219.

37.   Khalid M, Khan B, Al Rabiah F, Alismaili R, Saleemi S, Rehan-Khaliq AM, Weheba I, Al Abdely H, Halim M, Nadri QJ, Al Dalaan AM, Zeitouni M, Butt T and  Al Mutairy E. Middle Eastern Respiratory Syndrome Corona Virus (MERS CoV): case reports from a tertiary care hospital in Saudi Arabia. Ann Saudi Med. 34(5); 2014:396-400.

38.   Oh MD, Park WB, Park SW, Choe PG, Bang JH, Song KH, Kim ES, Kim HB, Kim NJ. Middle East respiratory syndrome: what we learned from the 2015 outbreak in the Republic of Korea. Korean J Intern Med.33(2); 2018:233-246.

39.   Aly M, Elrobh M, Alzayer M, Aljuhani S and  Balkhy H. Occurrence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) across the Gulf Corporation Council countries: Four years update. Plos one.12(10); 2017: e0183850.

40.   Cho SY, Kang JM, Ha YE, Park GE, Lee JY, Ko JH, Lee JY, Kim JM, Kang CI, Jo IJ, Ryu JG, Choi JR, Kim S, Huh HJ, Ki CS, Kang ES, Peck KR, Dhong HJ, Song JH, Chung DR and  Kim YJ. MERS-CoV outbreak following a single patient exposure in an emergency room in South Korea: an epidemiological outbreak study. Lancet. 388(10048); 2016:994–1001.

41.   Park SH, Kim YS, Jung Y, Choi SY, Cho NH, Jeong HW, Heo JY, Yoon JH, Lee J, Cheon S and Sohn KM. Outbreaks of Middle East Respiratory Syndrome in Two Hospitals Initiated by a Single Patient in Daejeon, South Korea. Infect Chemother.48(2); 2016:99-107.

42.   Sha J, LiY, Chen X, Hu Y, Ren Y, Geng X, Zhang Z and Liu S. Fatality risks for nosocomial outbreaks of Middle East respiratory syndrome coronavirus in the Middle East and South Korea. Arch Virol.162(1); 2017:33-44.

43.   Al salihi SF and Alrodhan MA. phylogenetic Analysis of MERSCoV in Human and Camels in Iraq.International Journal of Pharmaceutical Research and Allied Sciences. 6(1); 2017:120-129.

 

Accepted on 17.11.2019           © RJPT All right reserved

Research J. Pharm. and Tech 2020; 13(6):2578-2584.