INTRODUCTION:

In modern orthodontic practice, efficient tooth movement is essential to achieve optimal treatment outcomes, which include improved aesthetics and occlusion function¹. However, the long duration of orthodontic treatment often creates discomfort for patients. It increases the risk of oral health problems, flagging the need for methods to speed up this process without sacrificing the quality of the final result². In an effort to overcome these challenges, hyperbaric oxygen therapy (HBOT) and ethanol extract M. pendans (anthills) have been explored for their potential to speed up tooth movement ³. Both methods promise advances in the efficiency and convenience of orthodontic treatment by offering synergistic effects that support tissue healing and regeneration and optimize tooth movement. This research underscores the importance of developing new therapeutic strategies in orthodontics that shorten the treatment duration and ensure satisfactory outcomes for patients.

Hyperbaric oxygen therapy has been recognized for its potential to improve wound healing and tissue regeneration by providing pure oxygen at pressures higher than normal atmosphere⁴. Previous research has shown that HBOT can speed up the healing process by increasing the plasma oxygen concentration, which supports cellular metabolism and modulates the inflammatory response⁵. On the other hand, M. pendans, known as an anthill, has been used in traditional medicine and exhibits anti-inflammatory properties and an ability to support bone regeneration⁶. Extract M. pendans. It contains bioactive compounds that can potentially influence biological processes associated with tooth movement, mainly through their influence on osteoclast and osteoblast activity⁷.

The synergistic impact between HBOT and M. pendans against the acceleration of tooth movement in orthodontics can promote bone regeneration and modulation of inflammation⁸. In addition, hyperbaric oxygen therapy increases oxygen supply. It supports cell metabolism, while M. pendans offers anti-inflammatory properties and supports bone regeneration, jointly modulating osteoclasts, osteoblasts, and relevant gene expression⁹. A study by Eid (2010) proved the potential combination of HBOT and extracting M. pendans in accelerating the orthodontic process, which can significantly improve the efficiency and results of orthodontic treatment¹⁰.

HBOT and ethanol extract M. pendans therapy in accelerating incisive tooth movement in orthodontic treatment by increasing the expression of TNF-α and TGF-β genes that contribute to the modulation of inflammation and the formation of the extracellular matrix of alveolar bone¹¹. This experimental laboratory research aims to understand how combining these two therapies affects the biological environment, supports bone remodeling, and facilitates more efficient tooth movement. By evaluating cellular dynamics and relevant gene expression, the study seeks to provide new insights into the potential synergistic effects of HBOT and extract M. pendans, which can significantly improve the efficiency and results of orthodontic treatment.

MATERIAL AND METHODS:

This research has passed ethical research No. 281/VI/2023/KEPK Universitas Pembangunan Nasional Veteran, Jakarta, Indonesia. Based on the laboratory extraction protocol, extract preparation was obtained from the Chemistry Laboratory, Padjajaran University Bandung, Indonesia. A total of 25 animal models (Oryctolagus cuniculus) were divided into five groups: (1) Control, group without treatment; (2) T1, orthodontic movement administration group alone plus Vitamin D (2.5kg/1mL), (3) T2, orthodontic movement administration group and M. pendans extract 2% (2.5 kg/1mL), (4) orthodontic movement administration group and HBOT, (5) orthodontic movement administration group, M. pendans ethanol extract 2% and HBOT.

Animal Model Orthodontics:

In the described orthodontic treatment protocol for model animals, an open coil and stainless steel (SS) wire are prepared and installed between the incisors, with a force of 50grams applied. This setup is secured, and the coil is compressed to a specified length and measured accurately to ensure consistent force application. Before the installation of brackets, the incisors are thoroughly cleaned to prevent infection and ensure adequate adhesion. Brackets are then attached using bands that are welded and adjusted to fit the circumference of the tooth. They are further secured with glass ionomer cement for stability. The animal's response to the appliance is closely monitored throughout the treatment, with adjustments made as needed. Detailed documentation of the procedure and observations is maintained for research analysis and replication¹².

Orthodontic Therapy:

The Control Group and T1 did not get the HBOT session while undergoing orthodontic therapy with Hyperbaric Oxygen and M. pedans. Following the placement of orthodontic devices, the T3 and T4 groups had therapy for 3x30 minutes at 5-minute intervals using normal air. The treatment was conducted for ten days, specifically on days 5-14, in the animal chamber, with a daily pressure of 2.4 ATA. Subsequently, a 0.2 ATA/min pressure was applied until the pressure reached normal levels (1 ATA) to mitigate the risk of barotrauma and associated discomfort. The model animal was administered a beverage during therapy session¹³.

Measured Inter-Incisive Distance:

The distance between incisive teeth on the mesial side was measured using digital calipers starting on days 2, 5, 7, and 14. On the 14th day, which marks the end of the observation period, the orthodontic device attached to the incisive tooth is removed. Removal of the orthodontic appliance is carried out carefully. As an integral part of the research protocol, this tool's measurement and removal step assesses the dynamics of intelligent tooth movement in response to the treatment provided¹⁴.

TNF-α and TGF-β gene expression:

RT-qPCR was used by Gani (2019) to examine TNF-α and TGF-β expressions, and this method will be employed to analyze periodontal ligament tissue from teeth subjected to external stresses. Gingival tissue will be excluded to minimize inflammation from orthodontic devices. The RT-qPCR analysis begins with the placement of tissue in a preservation solution, followed by RNA extraction and purification using the Qiagen Rneasy Micro Kit (Merck Kega, Darmstadt, Germany). RNA stabilization during extraction is achieved by including RNA from the kit. Gene expression is measured using Meridian Bioscience's MyTaq One-Step RT PCR kit, with the sense primer for the TNF-α gene being 5'- CTGCACTTCAGGGTGATCG-3' and the antisense primer 5'- CTACGTGGGCTAGAGGCTTG-3'. For TGF-β, the sense primer is 5'- CAGTGGAAAGACCCCACATCTC, and the antisense primer is 5'- GACGCAGGCAGCAATTATCC. The PCR protocol involves enzyme activation for 3 min at 98^oC, followed by 45 cycles of 20 sec each at 98, 60, and 72^oC. Using the Rotor-Gene system, fluorescence detection is performed on FAM/SYBR channels at 72 oC. Relative gene expression levels are calculated by normalizing the expression using the LIVAK formula¹⁵.

Histopathological Assessment:

On the 14th day of the experiment, rabbits were decapitated following anesthesia administered via an overdose of 0.8mL of 10% Ketamine and 0.2mL of Xylazine injected intramuscularly into the right upper thigh. The rabbit's mandibular incisive teeth were dissected, cleaned with 0.9% NaCl, and fixed in a solution of 10% formalin buffer and 10% Ethylene Diamine Tetra Acetic Acid (EDTA), with the solution being changed daily for approximately two months until the specimens were soft enough for cutting. The specimens were then embedded in liquid paraffin at 48 °C to prepare paraffin blocks. Sections of the paraffin block were cut mesiodistally, parallel to the long axis of the incisive tooth, at a thickness of 4-6 μm using microtomes. Hematoxylin Eosin (HE) staining was applied to the sections and then mounted on preparation glass. Observations of the stained specimens were made using a light microscope at 400x magnification to calculate the number of osteoblasts and osteoclasts on the stress and strain sides, with averages of cell counts per square millimeter of total tissue area recorded and documented separately¹⁶.

Statistical Analysis:

One Way ANOVA analysis was conducted using IBM SPSS Statistics 23 to assess the significance of data related to interincisive distance, osteoclast and osteoblast cell development, and TNF-α and TGF-β gene expression. The Pearson correlation was also employed to evaluate the relationships between variables, with an R-value of 1 indicating a strong relationship and a significance threshold set at p < 0.05.

RESULTS:

Table 1 presents incisive tooth movement data after 14 days of orthodontic treatment on Oryctolagus cuniculus, and study subjects are grouped into five groups, including one control group and four treatment groups. In the control group that did not receive any treatment, the average intelligent tooth movement was recorded at 1.32 mm with a standard deviation (SD) of 0.02mm and a frequency of 'Normal' status of 11%, as well as a p-value of 2.49 resulting from One Way ANOVA analysis.

Table 1. Incisive tooth movement After 14 days of orthodontic treatment on Oryctolagus cuniculus

Groups	N	Distance between incisors (mm)			Status	*p-value
Groups	N	Mean	SD	Frequency	Status	*p-value
Control	5	1.32	0.02	11%	Normal	2.49
T1	5	2.09	0.18	18%	Increased
T2	5	2.78	0.10	24%	Increased
T3	5	2.78	0.08	24%	Increased
T4	5	2.66	0.09	23%	Increased

*One Way ANOVA, Control: Group without treatment (normal), T1: Group of orthodontic movements only, T2: Group of orthodontic movements and M. pendans, T3: Group of orthodontic movements and hyperbaric oxygen therapy, T4: Group of orthodontic movements, M. pendans and Hyperbaric oxygen therapy.

Treatment in the T1 group, given only orthodontic movements, showed an increase in movement average to 2.09mm with SD 0.18mm and 'Increased' status with a frequency of 18%. The T2 and T3 groups, which were given a combination of orthodontic movements with Anthill ethanol extract and orthodontic movements with HBOT, showed a more significant increase in movement, with the same moving average of 2.78mm, SD for T2 of 0.1mm and T3 of 0.08mm. Both had an 'Increased' status frequency of 24%. Meanwhile, the T4 group that received the combined treatment of orthodontic movement, Anthill ethanol extract, and HBOT showed an average movement of 2.66mm with an SD of 0.09mm and an 'Increased' status frequency of 23%, indicating that there was an increase in incisive tooth movement in all treatment groups compared to the control group. The T1 group showed the lowest increase in movement compared to the other treatment groups, while the T2 and T3 groups showed the same movement index, and T4 showed slightly lower movement than T2 and T3.

Table 2 presents the profiles of osteoclast and osteoblast cells in alveolar bone after orthodontic treatment in Oryctolagus cuniculus, dividing subjects into one control group and four treatment groups. In the control group, the mean number of osteoclasts was 38.48/mm2with a standard deviation (SD) of 2.66 and a frequency of 17%, while the mean number of osteoblasts was 31.46/mm2with an SD of 11.079 and a frequency of 16%. The p-value for the control group was recorded at 0.027.

In the treatment group, T1 showed an increase in the average number of osteoclasts to 47.68/mm2with SD 5.42 and frequency of 21%, and the average number of osteoblasts 35.26/mm2with SD 7.073 and 18%. The T2 group, which received a combination of orthodontic movements and M. pendans extract, showed an average osteoclast count of 47.48/mm2with SD 1.68 and a frequency of 21%, and a significant increase in the average number of osteoblasts to 50.06/mm2with SD 1.839 and a frequency of 26%. The T3 and T4 groups also showed variation in the average number of osteoclast and osteoblast cells, with T4 showing a significant increase in osteoblast count.

The results of the post hoc LSD test analysis in Table 1 revealed a statistically significant difference between the control group and the four treatment groups (p<0.05), which included a control group compared individually with T1, T2, T3, and T4. It showed that the treatment given to each group significantly improved incisive tooth movement compared to the control group, which did not receive any treatment.

A comparison between the number of osteoclast and osteoblast cells provides insight into the bone repair process. In orthodontics, high osteoclast activity indicates intensive bone resorption, while increased osteoblasts indicate active bone formation. Ideally, a balance between resorption and bone formation should be maintained to ensure effective tooth movement and stabilization of tooth position after treatment. The T2 group, with a significant increase in the number of osteoblasts, showed better bone repair potential compared to another group that showed a more variable comparison between osteoclasts and osteoblasts. An increase in osteoblasts, particularly in the group receiving combination therapy, indicates that combination treatments can facilitate a more efficient alveolar bone repair process after orthodontic treatment, supporting stabilization and maintenance of long-term treatment outcomes.

In the post hoc LSD test, Table 2 showed significant differences in the number of osteoblast cells between the control group and P2(p = 0.0004) and T4(p = 0.0069). In addition, there were significant differences between groups T1 and T2(p = 0.0033) and between T3 and T2 (p = 0.0001) and P4(p = 0.0023), indicating that variations in the treatment had different impacts on the number of osteoblast cells. For osteoclast cells, there was a significant difference between the control group with T1 (p = 0.0207) and T2 (p = 0.0183), indicating the effect of treatment on osteoclast cell activity.

Table 3 outlines the expression of TNF-α and TGF-β genes in alveolar bone after orthodontic treatment in Oryctolagus cuniculus, with data collected from five different groups, including a control group and four treatment groups. Without a control group, the control group established a baseline with mean gene expression concentrations for TNF-α and TGF-β of 1.00ng/mL, respectively, showing frequencies of 2% and 1% with significant p-values of 0.001.

The T1 group, which received only orthodontic movements, showed dramatic improvements in TNF-α and TGF-β expression with averages of 34.30ng/mL and 34.32ng/mL, respectively, showing 54% and 20% expression frequencies. The T2 and T3 groups, which received a combination of treatment with M. pendans and hyperbaric oxygen therapy, as well as both combinations, showed variation in the expression of both genes, with T3 recording a significant increase in TGF-β expression. Interestingly, the T4 group that received both combination treatments showed a decrease in TNF-α expression to 0.47ng/mL, while TGF-β expression was 21.19ng/mL.

Gene expression of TNF-α, which plays a role in the inflammatory response, and TGF-β, which is critical in tissue regeneration and maintenance, demonstrated the dynamics of alveolar bone repair after orthodontic treatment. Increased expression of TGF-β, in particular, indicates higher regenerative activity in the alveolar bone, favoring the restoration and maintenance of bone structure post-tooth movement. Decreased TNF-α expression in the T4 group suggested that a combination of hyperbaric oxygen therapy and M. pendans may effectively reduce the inflammatory response, facilitating a more conducive environment for bone regeneration. These results indicate that managing inflammatory and regenerative gene expression through specific therapeutic interventions can accelerate the process of alveolar bone repair and improve orthodontic treatment outcomes.

Post hoc LSD test Table 3 highlights significant differences in TNF-α gene expression between the T1 group with T4(p = 0.0012) and the control group (p = 0.0013). This suggests the effect of treatment on modulating the inflammatory response. Regarding TGF-β gene expression, there were significant differences between the control groups with T2(p = 0.048) and T3 (p = 0.0117), indicating differences in alveolar bone regenerative activity.

Figure 1 reports the cell profiles of osteoclasts and osteoblasts of alveolar bone after orthodontic treatment given treatment. Group A was a control animal model without any treatment, with osteoblast cell frequency still dominating and osteoclast slight, indicating normal bone development. In Group B, where the animal model was only given orthodontic treatment without any therapy, osteoclast cells dominated compared to osteoblast cells. In groups C and D, orthodontic model animals were given M. pendans therapy and hyperbaric oxygen therapy, where osteoblasts increased and osteoblasts as bone reabsorption areas decreased. Then, in Group E, orthodontic treatment of animal models treated with hyperbaric oxygen and M. pendans castration showed a better bone matrix formation process, as indicated by a high increase in osteoblast cells and almost no osteoclast cells found.

Figure 1. Alveolar bone cell profile in orthodontic needs of animal models. (A) Control Group, without treatment (normal), (B) Orthodontic movement administration group, (C) Orthodontic movement administration group and M. pendans, (D) Orthodontic movement administration group and hyperbaric oxygen therapy, (E) Orthodontic movement administration group, M. pendans and Hyperbaric oxygen therapy. Blue Arrow (Osteoblast Cells), Yellow Arrow (Osteoclast Cells). 400x magnification

Several treatment groups with different effects were found in studies exploring the impact of various treatments on alveolar bone remodeling in animal models undergoing orthodontic treatment (Figure 2). The T1 group, which accepts only orthodontic movements, provides the basis for understanding the mechanical effects of tooth movement. The T2 group, which added M. pendans to orthodontic movements, showed improvement in the bone-building process, signaling the potential for synergy between the treatments. Meanwhile, the T3 group, given additional hyperbaric oxygen therapy, did not stand out in any particular aspect compared to the other groups in the study.

In particular, the T4 group, which received a complete combination of orthodontic movements, M. pendans, and hyperbaric oxygen therapy, showed the most promising results. This combined therapy proved very effective, showing a strong synergistic effect in responding to alveolar bone remodeling, better than the other groups. On the other hand, the untreated control group provided a baseline for comparison. The study also revealed that the T1 and T2 groups had an excellent response to the expression of the TNF-α gene, which is related to inflammatory processes and bone resorption. In contrast, the T4 and control groups showed a positive response to the expression of the TGF-β gene, which plays an essential role in bone formation and tissue repair. These findings provide important insights into how combination orthodontic therapies can be optimized for better therapeutic effects in clinical practice.

Table 4 outlines the research results on the relationship between variables involved in structural and biological changes in alveolar bone after orthodontic treatment in Oryctolagus cuniculus. Correlation between variables is measured using Spearman's rho, which gives the correlation coefficient value and two-way significance (Sig. 2-tailed). The results of this study showed that, although there were some associations with high correlation coefficients, none of the relationships achieved statistical significance. This indicates that the alveolar bone remodeling process is complex and may be influenced by many interdependent factors not fully reflected in the correlation between variables presented in this study.

Figure 2. Evaluation of orthodontic fire in animal models. Assessment indicators are based on incisive tooth movement, osteoblast and osteoclast response of alveolar bone, and expression of TNF-α and TGB-β genes in gingival tissue. Control: Group without treatment (normal), T1: Group of orthodontic movement administration only, T2: Group of orthodontic movement administration and M. pendans, T3: Group of orthodontic movement administration and hyperbaric oxygen therapy, T4: Group of orthodontic movement administration, M. pendans and Hyperbaric oxygen therapy.

Table 4. Relationship between variables of incisive distance, gene expression, and alveolar bone cells after orthodontic treatment in Oryctolagus cuniculus

No	Group	N	Spearman's Rho Correlations		Description
No	Group	N	Correlation Coefficient	Sig. (2-tailed)	Description
1	Osteoclast-osteoblast	25	0.401	0.50	The correlation between the number of osteoclast and osteoblast cells showed a positive coefficient (0.401). Still, it showed no statistical significance (p = 0.50), indicating no strong relationship between the two variables in the sample tested.
2	Osteoclast- Insicor movement	25	0.76	0.13	The correlation between the number of osteoclast and osteoblast cells showed a positive coefficient (0.401). Still, it showed no statistical significance (p = 0.50), indicating no strong relationship between the two variables in the sample tested.
3	Osteoclast- TNF-α	25	0.701	0.187	The association between osteoclasts and TNF-α gene expression was also high (0.701). Still, there was an insignificant (p = 0.187) coefficient, indicating that despite the trend toward positive associations, the evidence was not strong enough to state a definitive relationship.
4	Osteoclast - TGF-β	25	0.735	0.57	TGF-β expression correlated highly with osteoclastic activity (0.735) but showed no statistical significance (p = 0.57).
5	Osteoblast- Insicor movement	25	0.492	0.400	The relationship between osteoblasts and incisive tooth movement was recorded with a moderate correlation coefficient (0.492) but insignificant (p = 0.400).
6	Osteoblast-TNF-α	25	-0.156	0.802	The association between osteoblasts and TNF-α and TGF-β gene expression was weak and insignificant, with correlation coefficients of -0.156 and -0.044 and high p-values (0.802 and 0.944), indicating no relevant correlation.
7	Osteoblast-TGF-β	25	-0.044	0.944
8	Incisor movement- TNF-α	25	0.109	0.861	Incisive tooth movement has a weak association with TNF-α gene expression (coefficient 0.109, p = 0.861) and a high association with TGF-β (0.775) but did not achieve statistical significance (p = 0.124).
9	Incisor movement- TGF-β	25	0.775	0.124
10	TNF-α- TGF-β	25	0.450	0.447	The association between TNF-α and TGF-β gene expression had a moderate (0.450) but not significant (p = 0.447) correlation coefficient.

DISCUSSION:

In orthodontics, efficient tooth movement is essential to achieve optimal aesthetic results and ensure correct occlusion function. Given the importance of efficient gear movement, strategies that speed up this process are invaluable. In this regard, hyperbaric oxygen therapy and ethanol extract from M. pendans, have emerged as promising candidates. These therapeutic modalities are hypothesized to modulate biological processes associated with tooth movement.

The findings of this study show the effectiveness of the combination of HBOT and ethanol extract M. pendans in accelerating the movement of incisive teeth in the context of orthodontic treatment, where the involvement of these two therapeutic capitals cellularly can improve alveolar bone in endodontic treatment, including changes in the number of osteoclast cells responsible for bone resorption, and osteoblasts involved in the formation of new bone. In addition, combination therapy can affect the expression of the pro-inflammatory gene TNF-α and the pro-regenerative gene TGF-β, which play an essential role in the bone remodeling process. Both of these genes play an important role in bone remodeling or remodeling, which is a dynamic process involving the resorption and formation of new bone ¹⁷.

By understanding the mechanisms behind changes in osteoclast and osteoblast cell numbers and modulating TNF-α and TGF-β gene expression, this study seeks to provide new insights into orthodontic practice that can aid in developing faster and more effective treatment methods ¹⁸. TNF-α is a cytokine that has an essential role in maintaining the inflammatory response. In the context of bone, TNF-α can increase the activity of osteoclasts responsible for bone resorption ¹⁹. Osteoclasts break down the bone matrix, so too much of its activity can reduce bone mass. Therefore, TNF-α is often associated with degenerative conditions such as osteoporosis. On the other hand, TGF-β is a growth factor that favors the proliferation and differentiation of osteoblasts, cells responsible for the synthesis of new bone matrix. TGF-β also aids in bone formation and repair of bone damage, making it crucial in the regeneration process ²⁰.

Analysis of data from this study Table 1 showed that the T2 and T3 groups, who received a combination of orthodontic treatment with ethanol extract of M. pendans (T2) and hyperbaric oxygen therapy (T3), experienced a more significant improvement in incisive tooth movement compared to the T1 group who received only orthodontic treatment and T4 who received a combination of both therapies. Incisive gear movements were recorded at 2.78±0.10 mm for T2 and 2.78±0.08 mm for T3, statistically higher than 2.66±0.09 mm for T1 and 2.09±0.18 mm for T4.

These findings are consistent with previous studies showing that the extract M. pendans has anti-inflammatory effects that can improve bone healing and regeneration, facilitating tooth movement ²¹. In addition, research by Gorski (2022) has underlined how HBOT can improve the supply of oxygen and nutrients to bone tissue, which is essential for bone healing and regeneration processes, supporting faster and more efficient tooth movement ²². The significant increase in tooth movement in the T2 and T3 groups confirms the synergistic potential between applying orthodontic mechanical forces and modulation of the biological environment through herbal extracts and oxygen therapy. This combination of therapies might accelerate the alveolar bone remodeling process in ways that cannot be achieved through standard orthodontic therapy alone ²³.

The T4 group, who received all therapies combined, did not show the expected improvement in tooth movement. This could be because the synergistic effect between the extracts M.Pendans and HBOT is not linear and may reach a saturation point or even counterproductive when combined, as indicated by lower yields compared to T2 and T3. This demonstrates the importance of finding the correct dosage and combination of therapeutic interventions to maximize the effectiveness of orthodontic treatment. This research offers valuable insights into the potential of combination therapy in orthodontics. Still, further exploration is required to understand the exact mechanisms and establish clinical guidelines to maximize benefits while minimizing risk ²⁴.

The research from Table 2 combines osteoclastic and osteoblastic activity analyses in the context of incisive tooth movement in Oryctolagus cuniculus, revealing the complex dynamics between resorption and bone formation during orthodontic treatment. Results showed that the T4 (44.36±7.14 mm²) and T3 (45.84±8.34 mm²) groups experienced lower bone resorption compared to the T2 (47.48±1.68 mm²) and T1 (47.68±5.42 mm²) groups, while bone formation was most effective in the T2 (50.06±1.83) and T4 (44.26±6.26) groups, compared to the T1 (35.26±7.07) and T3 (29.34±5.51) groups. The lower bone resorption in the T3 and T4 groups can be explained by the application of HBOT, which supports the hypothesis that HBOT facilitates a more conducive environment for bone maintenance by increasing oxygen availability ²⁵. This effect may reduce osteoclastic activity, which is responsible for bone resorption. The T4 group received a combination of therapies, including HBOT and M. Pendans. Group T2, which receives M. pendans, shows significant bone formation, which supports previous findings about the plant extract's potential to support bone regeneration ²⁶. Meanwhile, the T4 group showed that combined therapy, although not maximizing bone formation as much M. pendans alone, still contributes significantly to this process. More research is needed to optimize therapeutic protocols and understand the exact mechanisms behind these observational effects, including the potential long-term effects on bone and periodontal tissue health ²⁷.

Research results from the Table. 3 highlights the critical role of gene expression in inflammatory processes and bone matrix formation during orthodontic treatment. Decreased TNF-α expression in the T4 group suggests that combined therapy M. pendans and HBOT may have powerful anti-inflammatory effects, consistent with previous research that found that M. Pendans has anti-inflammatory potential. HBOT may reduce inflammation through increased oxygen supply and decreased oxidative stress ²⁸. This reduction of inflammation is essential to reduce the risk of tissue damage during tooth movement and to speed up the healing process. TGF-β is an important growth factor in bone formation and tissue regeneration ²⁹. High expression of TGF-β in the group receiving HBOT and M. Pendans demonstrated that both therapies promote osteoblastic activity, essential for effective bone formation during orthodontic treatment.

Figure 2 reports an Analysis of stock performance in the context of this study and shows that TNF-α and TGF-β gene expression has a dominant role, with a contribution of 60%, in the process of alveolar bone repair in orthodontic animal models. Meanwhile, other parameters, such as incisive tooth movement, osteoclast cell activity, and osteoblasts, contribute 20% to the repair process. This suggests that genetic interactions and biological responses at the molecular level play a more significant role than previously thought in orthodontic processes, particularly in the context of bone repair ³⁰. The relationship between the impact of various treatments on alveolar bone remodeling in orthodontic animal models highlights the interaction between the mechanical movement of teeth and biological responses induced by adjuvant therapy. Results showed that orthodontic movement alone (Group T1) triggered bone resorption, consistent with previous findings by Smith et al. Adding M. pendans (Group T2) showed a synergistic effect that improved bone formation, supported by the herb's anti-inflammatory properties identified by Lee et al.

In contrast, hyperbaric oxygen therapy (Group T3) does not provide significant benefits without proper adjustment of parameters. The T4 group combined all treatments and showed the most substantial synergistic effect in accelerating healing and improving bone quality. This study underscores the importance of a holistic approach in orthodontic therapy that integrates mechanical and biological aspects for more optimal and sustainable results³¹. These results confirm that modulation of the expression of specific genes can be an effective strategy in alveolar bone repair, which is important for improving orthodontic treatment outcomes.

Conclusion:

The combination of Hyperbaric Oxygen Therapy and M. pendans shows significant potential in accelerating incisive tooth movement in orthodontic treatment. The synergistic effect of these two therapies can modulate the alveolar bone's biological environment, facilitate more effective bone remodeling, and support faster tooth movement. This research provides new insights into developing therapeutic strategies to improve the efficiency of orthodontic treatments.

Conflict of Interest:

We have agreed that there is no conflict of interest.

References:

1. Gkantidis N, Christou P, Topouzelis N. The orthodontic–periodontic interrelationship in integrated treatment challenges: a systematic review. Journal of Oral Rehabilitation. 2010; 37(5): 377-90. https://doi.org/10.1111/j.1365-2842.2010.02068.x

2. De Molon RS, de Avila ED, Cirelli JA, et al. Optimizing maxillary aesthetics of a severe compromised tooth through orthodontic movement and dental implants. Case Reports in Dentistry. 2014; 2014. https://doi.org/10.1155%2F2014%2F103808.

3. Akbar YM, Maskoen AM, Mardiati E, Wandawa G, Setiawan AS. Potential Use of Hyperbaric Oxygen Therapy in Orthodontic Treatment: A Systematic Review of Animal Studies. Eur J Dent. 2023; 17(1): 16-23. https://doi.org/10.1055/s-0042-1755625

4. Ortega MA, Fraile-Martinez O, García-Montero C, et al. A general overview on the hyperbaric oxygen therapy: applications, mechanisms and translational opportunities. Medicina 2021; 57(9): 864. https://doi.org/10.3390%2Fmedicina57090864

5. Gottrup F, Dissemond J, Baines C, et al. Use of oxygen therapies in wound healing: focus on topical and hyperbaric oxygen treatment. Journal of wound care. 2017; 26(Sup5): S1-S43. https://doi.org/10.12968/jowc.2017.26.sup5.s1

6. Sudiono J, Hardina M. The effect of Myrmecodia pendans ethanol extract on inflamed pulp: study on sprague dawley rats. Molecular and Cellular Biomedical Sciences. 2019; 3(2): 115-21. https://doi.org/10.21705/mcbs.v3i2.70

7. Nikolova MP, Apostolova MD. Advances in multifunctional bioactive coatings for metallic bone implants. Materials 2022; 16(1): 183. https://doi.org/10.3390/ma16010183

8. Prameswari N, Sunaryo IR, Damaiyanti DW, Febrina A. The influence of hyperbaric oxygen therapy (HBOT) to intercausal relationship between blood vessels, osteoblast, and new bone formation during maxillary suture expansion. Padjadjaran Journal of Dentistry. 2020; 32(1): 14-21. https://doi.org/10.24198/pjd.vol32no1.19684

9. Gardin C, Bosco G, Ferroni L, et al. Hyperbaric Oxygen Therapy Improves the Osteogenic and Vasculogenic Properties of Mesenchymal Stem Cells in the Presence of Inflammation In Vitro. Int J Mol Sci. 2020; 21(4). https://doi.org/10.3390%2Fijms21041452

10. Eid H, Sayed W. Effect of hyperbaric oxygen mobility of orthodontically treated teeth. Egyptian Orthodontic Journal. 2010;38:107-24. http://dx.doi.org/10.21608/eos.2010.79029

11. Yasin JJ, Brahmanta A, Pargaputri AF. Innovation of Hyperbaric Oxygen Therapy and Stichopus hermanii to The Amount of Macrophages in Periodontal Ligaments in Pressure and Tension Areas During Orthodontic Tooth Movement. DENTA 2019; 13(1): 1-10.

12. Alamsyah Y, Ilyas S, Putra DP. The Mangiferin (Mangifera Indica Linn) Effect Against the Calcium Degradation, Bones Resorption and Ossification of Rattus novergicus of Post-orthodontic treatment. Journal of International Dental and Medical Research 2020; 13(2): 430-35.

13. Gholamalizadeh A, Nazifkerdar S, Safdarian N, et al. Critical elements in tissue engineering of craniofacial malformations. Regenerative Medicine. 2023; 18(6): 487-504. https://doi.org/10.2217/rme-2022-0128

14. Thiruvevenkadam IA, Ling LT. Effect of cervical extensor strengthening on severity of temporomandibular joint disorder among university students: A randomized controlled trial. Research Journal of Pharmacy and Technology. 2021; 14(4): 2233-42. https://doi.org/10.52711/0974-360X.2021.00397

15. Yuli N, Wibi R, Nur P, Edy W, Respati SD. Effect of Aloe vera gel on the expression of FGF-2, TGF-β, and Smad3 in the root surface of rat teeth after Traumatic avulsion. Research Journal of Pharmacy and Technology. 2019; 12(9): 4405-09. https://doi.org/10.5958/0974-360X.2019.00758.3

16. Sumalatha S, Tantri G, Shreshta J, et al. Evaluation of an Ayurvedic preparation-‘Ekangaveera Rasa’for possible metal toxicity: Behavioral, biochemical and histopathological analysis. Research Journal of Pharmacy and Technology. 2021; 14(12): 6491-95. https://doi.org/10.52711/0974-360X.2021.01122

17. Roy T, Chakraborty P, Chowdhury RR, Chatterjee TK. Possible Beneficial Role of Novel Anti-Osteoarthritic Drug Diacerein in Rheumatoid Arthritis. Research Journal of Pharmacy and Technology. 2022; 15(6): 2715-20. https://doi.org/10.52711/0974-360X.2022.00454

18. Guru SR, Aghanashini S, Saroch N. Adipokines in periodontal disease-Culprits or accomplice? Research Journal of Pharmacy and Technology. 2023; 16(4): 2061-67. https://doi.org/10.52711/0974-360X.2023.00339

19. Ahmad F, Surapaneni KM, Al-Subaie AM, Kamaraj B. Insight into Ethnopharmacology of Quercus Infectoria with the possible mechanism of action. Research Journal of Pharmacy and Technology. 2023; 16(8): 3999-4006. https://doi.org/10.52711/0974-360X.2023.00656

20. Amin MN, Permatasari N. The role of stem cell on orthodontic tooth movement induced-alveolar bone remodeling. Research Journal of Pharmacy and Technology. 2023; 16(1): 123-28. https://doi.org/10.52711/0974-360X.2023.00023

21. Dharsono HDA, Mujahid M, Apriyanti E, et al. Tannin derived from Uncaria gambir Roxb. as potential Enterococcus faecalis UDP-N-Acetylenolpyruvoyl-Glucosamine Reductase (Mur Benzyme) inhibitor: In-silico antibacterial study. Research Journal of Pharmacy and Technology 2023; 16(10): 4568-74. https://doi.org/10.52711/0974-360X.2023.00744

22. Górski K, Stefanik E, Bereznowski A, Polkowska I, Turek B. Application of hyperbaric oxygen therapy (HBOT) as a healing aid after extraction of incisors in the equine odontoclastic tooth resorption and hypercementosis syndrome. Veterinary Sciences 2022; 9(1): 30. https://doi.org/10.3390%2Fvetsci9010030

23. Cho Y-D, Kim K-H, Lee Y-M, Ku Y, Seol Y-J. Periodontal wound healing and tissue regeneration: a narrative review. Pharmaceuticals 2021; 14(5): 456. https://doi.org/10.3390/ph14050456

24. Krishnan V, Davidovitch Ze, Kuijpers‐Jagtman AM. The Increased Stature of Orthodontics. Integrated Clinical Orthodontics 2023: 1-17. http://dx.doi.org/10.1002/9781119870081.ch1

25. Liu Z, Liu Q, Guo H, Liang J, Zhang Y. Overview of physical and pharmacological therapy in enhancing bone regeneration formation during distraction osteogenesis. Frontiers in Cell and Developmental Biology 2022; 10: 837430. https://doi.org/10.3389/fcell.2022.837430

26. Umiatin U, Hadisoebroto Dilogo I, Sari P, Kusuma Wijaya S. Histological analysis of bone callus in delayed union model fracture healing stimulated with pulsed electromagnetic fields (PEMF). Scientifica 2021; 2021. https://doi.org/10.1155/2021/4791172

27. Sadek KM, El Moshy S, Radwan IA, et al. Molecular basis beyond interrelated bone resorption/regeneration in periodontal diseases: a concise review. International Journal of Molecular Sciences. 2023; 24(5): 4599. https://doi.org/10.3390/ijms24054599

28. Kim HN. Bioengineered growth factor delivery molecules for vascularisation and wound healing [UNSW Sydney; 2021. http://dx.doi.org/10.1002/anbr.202300131

29. Poniatowski ŁA, Wojdasiewicz P, Gasik R, Szukiewicz D. Transforming growth factor Beta family: insight into the role of growth factors in regulation of fracture healing biology and potential clinical applications. Mediators of inflammation 2015; 2015. https://doi.org/10.1155/2015/137823

30. Li Y, Zhan Q, Bao M, Yi J, Li Y. Biomechanical and biological responses of periodontium in orthodontic tooth movement: up-date in a new decade. International Journal of Oral Science. 2021; 13(1): 20. https://doi.org/10.1038/s41368-021-00125-5

31. Yamaguchi M, Garlet GP. The role of inflammation in defining the type and pattern of tissue response in orthodontic tooth movement. Biological mechanisms of tooth movement: Second edition 2015: 121-37. https://doi.org/10.1111/j.1365-2842.2010.02068.x

Received on 17.04.2024 Revised on 07.08.2024

Accepted on 24.10.2024 Published on 27.03.2025

Available online from March 27, 2025

Research J. Pharmacy and Technology. 2025;18(3):1209-1217.

DOI: 10.52711/0974-360X.2025.00175

This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License. Creative Commons License.

Groups	N	Bone Cell (mm2)						*p-value
		Osteoclast			Osteoblast
		Mean	SD	Frequency	Mean	SD	Frequency
Control	5	38.48	2.66	17%	31.46	11.079	16%	0.027
T1	5	47.68	5.42	21%	35.26	7.073	18%
T2	5	47.48	1.68	21%	50.06	1.839	26%
T3	5	45.84	8.38	20%	29.34	5.519	15%
T4	5	44.36	7.14	20%	44.82	6.264	23%
*p-value	25	0.1047			0.0005

Groups	N	Concentration of Gene Expression (ng/mL)						*p-value
		TNF-α			TGF-β
		Mean	SD	Frequency	Mean	SD	Frequency
Control	5	1.00	0.00	2%	1.00	0.00	1%	0.001
T1	5	34.30	3.39	54%	34.32	7.91	20%
T2	5	13.30	1.17	21%	44.87	26.71	26%
T3	5	14.74	1.81	23%	68.45	72.57	40%
T4	5	0.47	0.20	1%	21.19	6.89	12%
*p-value	25	0.0076			0.0779